The program maps a short sequence to a specified genome and outputs the list of the chromosome regions where the sequence of interest is found at a certain degree of homology.
Program options:
Search uniqueness - searching for the sequence in the genome.
Generate new sequence - generating the file reporting the number of copies of the sequence specified found in the genome (see output example).
Verbose alignment output - supplementing the result with sequences of block alignments.
Output example with "Search uniqueness" option:
Sequence 1 found: 18 L:246127941 Sequence chr1 [DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 24680544 1 L: 22, G: 81.818, W: 100, S:6.15457 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 75846196 1 L: 22, G: 81.818, W: 100, S:6.15457 L:199344050 Sequence chr3 [DD] Sequence: 1( 1), S: 8.1104, L:22 cut1 of chr22 Block of alignment: 2 1 P: 115760898 1 L: 22, G: 81.818, W: 100, S:6.15457 2 P: 45403606 1 L: 22, G: 81.818, W: 100, S:6.15457 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 169316451 1 L: 22, G: 81.818, W: 100, S:6.15457 L:181034922 Sequence chr5 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 135748025 1 L: 22, G: 81.818, W: 100, S:6.15457 L:170914576 Sequence chr6 [DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 128565689 1 L: 22, G: 81.818, W: 100, S:6.15457 L:158545518 Sequence chr7 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 54503919 1 L: 22, G: 81.818, W: 100, S:6.15457 L:146308819 Sequence chr8 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 10488747 1 L: 22, G: 81.818, W: 100, S:6.15457 L:134482954 Sequence chr11 [DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 69945455 1 L: 22, G: 81.818, W: 100, S:6.15457 L:105311216 Sequence chr14 [DR] Sequence: 1( 1), S: 8.1104, L:22 cut1 of chr22 Block of alignment: 2 1 P: 44339778 1 L: 22, G: 81.818, W: 100, S:6.15457 2 P: 92116275 1 L: 22, G: 81.818, W: 100, S:6.15457 L:100256656 Sequence chr15 [DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 34423244 1 L: 22, G: 81.818, W: 100, S:6.15457 L:90041932 Sequence chr16 [DR] Sequence: 1( 1), S: 9.9494, L:22 cut1 of chr22 Block of alignment: 3 1 P: 80986058 1 L: 22, G: 81.818, W: 100, S:6.15457 2 P: 88046952 1 L: 22, G: 86.364, W: 130, S:6.64694 3 P: 29307765 1 L: 22, G: 81.818, W: 100, S:6.15457 L:81860266 Sequence chr17 [DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22 Block of alignment: 1 1 P: 55043280 1 L: 22, G: 81.818, W: 100, S:6.15457 L:49396972 Sequence chr22 [DD] Sequence: 1( 1), S: 8.124, L:22 cut1 of chr22 Block of alignment: 1 1 P: 49014410 1 L: 22, G: 100.000, W: 220, S:8.12404
where: "Sequence 1 found: 18" - the number of copies of target sequence 1 found in the genome; "L:246127941 Sequence chr1" - the length and name of the chromosome whereto the target sequence aligned; "[DD]" - directions of the chromosome strand and target sequence; "Sequence: 1( 1)" - alignment number within particular site; "S: 6.1546" - alignment score; "L:22 cut1 of chr22" - alignment length; "Block of alignment: 1" - number of alignment blocks found; "1 Ð: 24680544 1" - positions of alignment blocks on the chromosome and in the target sequence; "L: 22" - length of alignment block; "G: 81.818" - degree of homology of alignment block; "W: 100" - weight of alignment block; "S:6.15457" - score value of alignment block.
Output example with "Generate new sequence" option:
>cut1 of chr22|in hg16 found 18 ggggtccttgaagaatgaggcg >cut2 of chr22|in hg16 found 12 gactgtgtccagtgtgag >cut3 of chr22|in hg16 found 54 gcgcccccgcctgacc