OLIGO_MAP / map sequences on genomes
Paste sequence here: >cut1 of chr22 ggggtccttgaagaatgaggcg >cut2 of chr22 gactgtgtccagtgtgag >cut3 of chr22 gcgcccccgcctgacc
Alternatively, load a local file with sequence: Local file name:
Genome set: humanmouserat needed Homology for each olig in set (0-100) allowed maximal number of mismatch (0, 1...) MINIMAL numder of matches Search uniqness Generate new sequence Verbose alignment output
Advanced options:
[Help] [Hide advanced options] [Program's page]
Your use of Softberry programs signifies that you accept Terms of Use
Last modification date: 14 Sep 2007