Services Test Online

SMAP - mapping oligonucleotides to genome

The program maps a short sequence to a specified genome and outputs the list of the chromosome regions where the sequence of interest is found at a certain degree of homology.

Program options:
Search uniqueness - searching for the sequence in the genome.
Generate new sequence - generating the file reporting the number of copies of the sequence specified found in the genome (see output example).
Verbose alignment output - supplementing the result with sequences of block alignments.

Output example with "Search uniqueness" option:

Sequence 1 found: 18
L:246127941  Sequence chr1
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 24680544       1 L:      22, G:  81.818, W:    100, S:6.15457
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 75846196       1 L:      22, G:  81.818, W:    100, S:6.15457
L:199344050  Sequence chr3
[DD] Sequence:       1(      1), S:      8.1104, L:22 cut1 of chr22
Block of alignment: 2        
    1 P: 115760898       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 45403606       1 L:      22, G:  81.818, W:    100, S:6.15457
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 169316451       1 L:      22, G:  81.818, W:    100, S:6.15457
L:181034922  Sequence chr5
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 135748025       1 L:      22, G:  81.818, W:    100, S:6.15457
L:170914576  Sequence chr6
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 128565689       1 L:      22, G:  81.818, W:    100, S:6.15457
L:158545518  Sequence chr7
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 54503919       1 L:      22, G:  81.818, W:    100, S:6.15457
L:146308819  Sequence chr8
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 10488747       1 L:      22, G:  81.818, W:    100, S:6.15457
L:134482954  Sequence chr11
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 69945455       1 L:      22, G:  81.818, W:    100, S:6.15457
L:105311216  Sequence chr14
[DR] Sequence:       1(      1), S:      8.1104, L:22 cut1 of chr22
Block of alignment: 2        
    1 P: 44339778       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 92116275       1 L:      22, G:  81.818, W:    100, S:6.15457
L:100256656  Sequence chr15
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 34423244       1 L:      22, G:  81.818, W:    100, S:6.15457
L:90041932   Sequence chr16
[DR] Sequence:       1(      1), S:      9.9494, L:22 cut1 of chr22
Block of alignment: 3        
    1 P: 80986058       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 88046952       1 L:      22, G:  86.364, W:    130, S:6.64694
    3 P: 29307765       1 L:      22, G:  81.818, W:    100, S:6.15457
L:81860266   Sequence chr17
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 55043280       1 L:      22, G:  81.818, W:    100, S:6.15457
L:49396972   Sequence chr22
[DD] Sequence:       1(      1), S:       8.124, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 49014410       1 L:      22, G: 100.000, W:    220, S:8.12404

where: "Sequence 1 found: 18" - the number of copies of target sequence 1 found in the genome; "L:246127941 Sequence chr1" - the length and name of the chromosome whereto the target sequence aligned; "[DD]" - directions of the chromosome strand and target sequence; "Sequence: 1( 1)" - alignment number within particular site; "S: 6.1546" - alignment score; "L:22 cut1 of chr22" - alignment length; "Block of alignment: 1" - number of alignment blocks found; "1 Ð: 24680544 1" - positions of alignment blocks on the chromosome and in the target sequence; "L: 22" - length of alignment block; "G: 81.818" - degree of homology of alignment block; "W: 100" - weight of alignment block; "S:6.15457" - score value of alignment block.

Output example with "Generate new sequence" option:

>cut1 of chr22|in hg16 found 18
ggggtccttgaagaatgaggcg
>cut2 of chr22|in hg16 found 12
gactgtgtccagtgtgag
>cut3 of chr22|in hg16 found 54
gcgcccccgcctgacc