> PLPR0088 ..AC:U34754 ..OS:Phaseolus vulgaris ..GENE:cellulase ..PROD:cellulase ..[ -200:  +51] ..CDS:+38 ..TSS:201 (+1) |Taxon: Dicot |Promoter: TATA
  Nucleotide Frequencies:  A -  0.26   G -  0.14   T -  0.34   C -  0.27

      1  ccttaaataa ataattattc caattcctaa gtaccctacc tccgtgactc
     51  gttccgtctg gctttgatta attaattttc atagtcatta ctgcacgtca
    101  ctctatctcc cattccacct ccacttcatg aagttatcta gcagttaggt
    151  aatgccgcat gcatttccct cTATATATAc gcactagctt ccgagtttag
    201  CTGAATCACG AGATCGATTA GCTCATACTC ATATATCATG GGGTACCATT
    251  C

  RE motifs found (positions are given in relation to TSS at 201; Mismatches - in lower case):

AC RSP00399   Mean Expected Number 0.002   +strand   -108 : -101   GCACGTCA
AC RSP00681   Mean Expected Number 0.002   -strand   -127 : -135   TAATTAATC
AC RSP00709   Mean Expected Number 0.003   -strand   -184 : -192   TAATTATTT
AC RSP01008   Mean Expected Number 0.006   -strand    -51 :  -57   ACCTAAC
AC RSP01088   Mean Expected Number 0.001   +strand    +41 :  +48   GGGTACCA
AC RSP01235   Mean Expected Number 0.000   +strand   -116 :  -93   TCATTACTGCACGTCACTCTATCT
AC RSP01236   Mean Expected Number 0.001   +strand   -122 : -113   TCATAGTCAT
AC RSP01237   Mean Expected Number 0.001   +strand    -32 :  -23   CTCTATATAT
AC RSP01654   Mean Expected Number 0.009   -strand    -99 : -108   AGTGACGTGC

  Totally       9 motifs of     9 different REs have been found


Description of REs found

  381. Group TF: AP1-like leucine zipper TF /AC: RSP00399//OS: Nicotiana tabacum /GENE: RNP2/RE: ATF /TF: AP1-like leucine zipper TF ||Identical REs AC:  RSP00884
  650. Group RE: Box 4 /AC: RSP00681//OS: Pisum sativum /GENE: PSPAL2/RE: Box 4 /TF: unknown
  675. Group RE: I-box /AC: RSP00709//OS: Pisum sativum /GENE: TOP2/RE: I-box /TF: unknown
  933. Group TF: PtMYB1; PtMYB4 /AC: RSP01008//OS: Pinus sylvestris /GENE: PsGS1b/RE: GS1b AC box 3 (AC-III) /TF: PtMYB1; PtMYB4 ||Identical REs AC:  RSP01455
 1006. Group TF: CRR1 /AC: RSP01088//OS: Helianthus annuus /GENE: CYC6;  CPX1; CRD1; CTR; CTH1locus;/RE: CuRE 2 /TF: CRR1
 1140. Group TF: TGA-type bZIP TF /AC: RSP01235//OS: Phaseolus vulgaris /GENE: BAC/RE: 24 bp Z-BAC+ /TF: TGA-type bZIP TF
 1141. Group RE: 10 bp Z-BAC- /AC: RSP01236//OS: Phaseolus vulgaris /GENE: BAC/RE: 10 bp Z-BAC- /TF: unknown
 1142. Group RE: -23 Z-BAC+ /AC: RSP01237//OS: Phaseolus vulgaris /GENE: BAC/RE: -23 Z-BAC+ /TF: unknown
 1472. Group TF: STF1/HY5 /AC: RSP01654//OS: Arabidopsis thaliana /GENE: Synthetic OLIGO/RE: STF1/HY5 BS (cons) /TF: STF1/HY5

Download This Page
Download Promoter Sequence in FASTA Format