> PLPR0088 ..AC:U34754 ..OS:Phaseolus vulgaris ..GENE:cellulase ..PROD:cellulase ..[ -200: +51] ..CDS:+38 ..TSS:201 (+1) |Taxon: Dicot |Promoter: TATA
Nucleotide Frequencies: A - 0.26 G - 0.14 T - 0.34 C - 0.27
1 ccttaaataa ataattattc caattcctaa gtaccctacc tccgtgactc
51 gttccgtctg gctttgatta attaattttc atagtcatta ctgcacgtca
101 ctctatctcc cattccacct ccacttcatg aagttatcta gcagttaggt
151 aatgccgcat gcatttccct cTATATATAc gcactagctt ccgagtttag
201 CTGAATCACG AGATCGATTA GCTCATACTC ATATATCATG GGGTACCATT
251 C
RE motifs found (positions are given in relation to TSS at 201; Mismatches - in lower case):
AC RSP00399 Mean Expected Number 0.002 +strand -108 : -101 GCACGTCA
AC RSP00681 Mean Expected Number 0.002 -strand -127 : -135 TAATTAATC
AC RSP00709 Mean Expected Number 0.003 -strand -184 : -192 TAATTATTT
AC RSP01008 Mean Expected Number 0.006 -strand -51 : -57 ACCTAAC
AC RSP01088 Mean Expected Number 0.001 +strand +41 : +48 GGGTACCA
AC RSP01235 Mean Expected Number 0.000 +strand -116 : -93 TCATTACTGCACGTCACTCTATCT
AC RSP01236 Mean Expected Number 0.001 +strand -122 : -113 TCATAGTCAT
AC RSP01237 Mean Expected Number 0.001 +strand -32 : -23 CTCTATATAT
AC RSP01654 Mean Expected Number 0.009 -strand -99 : -108 AGTGACGTGC
Totally 9 motifs of 9 different REs have been found
Description of REs found
381. Group TF: AP1-like leucine zipper TF /AC: RSP00399//OS: Nicotiana tabacum /GENE: RNP2/RE: ATF /TF: AP1-like leucine zipper TF ||Identical REs AC: RSP00884
650. Group RE: Box 4 /AC: RSP00681//OS: Pisum sativum /GENE: PSPAL2/RE: Box 4 /TF: unknown
675. Group RE: I-box /AC: RSP00709//OS: Pisum sativum /GENE: TOP2/RE: I-box /TF: unknown
933. Group TF: PtMYB1; PtMYB4 /AC: RSP01008//OS: Pinus sylvestris /GENE: PsGS1b/RE: GS1b AC box 3 (AC-III) /TF: PtMYB1; PtMYB4 ||Identical REs AC: RSP01455
1006. Group TF: CRR1 /AC: RSP01088//OS: Helianthus annuus /GENE: CYC6; CPX1; CRD1; CTR; CTH1locus;/RE: CuRE 2 /TF: CRR1
1140. Group TF: TGA-type bZIP TF /AC: RSP01235//OS: Phaseolus vulgaris /GENE: BAC/RE: 24 bp Z-BAC+ /TF: TGA-type bZIP TF
1141. Group RE: 10 bp Z-BAC- /AC: RSP01236//OS: Phaseolus vulgaris /GENE: BAC/RE: 10 bp Z-BAC- /TF: unknown
1142. Group RE: -23 Z-BAC+ /AC: RSP01237//OS: Phaseolus vulgaris /GENE: BAC/RE: -23 Z-BAC+ /TF: unknown
1472. Group TF: STF1/HY5 /AC: RSP01654//OS: Arabidopsis thaliana /GENE: Synthetic OLIGO/RE: STF1/HY5 BS (cons) /TF: STF1/HY5
Download This Page
Download Promoter Sequence in FASTA Format