Fish Physiol Biochem
2016 24 December 2016 pp 1–23 doi:10.1007/s10695-016-0328-x
Characterization of kiss2 and kissr2 genes and the regulation of kisspeptin on the HPG axis in Cynoglossus semilaevis
Song, H. et al.,
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life SciencesOcean University of ChinaQingdaoPeople’s Republic of China
... The Neural Network Promoter Prediction (http://www. fruitfly.org/seq_tools/promoter.htm) and
FPROM by Softberry (http://www.softberry.com/berry. phtml?topic=fprom&group=
programs&subgroup= promoter) were used for the online prediction of transcription start sites ( ...
Fish physiology and biochemistry
2016, 1-20. DOI 10.1007/s10695-016-0199-1
Identification and characterization of kiss2 and kissr2 homologs in Paralichthys olivaceus
Song, H. et al.,
1. Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, 266003, People’s Republic of China
... The transcription start sites (TSSs) were predicted using Softberry (http://?linux1.?softberry.?
com/?berry.?phtml??topic=?fprom&?group=?programs&?subgroup=?promoter), and
transcription factor binding sites were analyzed with the help of TFSEARCH (http://?www.?cbrc ...
General and comparative endocrinology
2015, 214, 114-125. doi:10.1016/j.ygcen.2014.06.010
Characterisation of kisspeptin system genes in an ovoviviparous teleost: Sebastes schlegeli
Song, H. et al.,
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, PR China
... The tool of Promoter Scan (http://www-bimas.cit.nih.gov/molbio/proscan/), Softberry
(http://linux1.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter),
and NNPP (http://www.fruitfly.org/seq_tools/promoter.html) were used to predict the transcription .
Scientific Reports
2015, 5, Article number: 14093 doi:10.1038/srep14093
Living without DAT: Loss and compensation of the dopamine transporter gene in sauropsids (birds and reptiles)
P. V. Lovell, B. Kasimi, J. Carleton, T. A. Velho & C. V. Mello
Department of Behavioral Neuroscience; Oregon Health & Science University; Portland, OR 97239-3098; USA
Department of Biology; Portland State University; Portland, OR 97207-0751; USA
... In some cases we were able to refine, or computationally validate the location of the TSS by
scanning each promoter region with algorithms available through Softberry (http://linux1.softberry.
om/berry.phtml) that predict TSSs based on the position of TATA or non-TATA promoter sequences (FPROM41), or the location of CpG-rich islands (CpGFinder). ...
International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573
The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53
Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China
... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools:
NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp.
duke.edu/generegulation/McPromoterMMII/), and Softberry programs
FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...
Scientia Horticulturae
Volume 154, 2 May 2013, Pages 96–101 DOI: 10.1016/j.scienta.2013.02.009
The intron from the 5?-UTR of the FBP11 gene in petunia displays promoter- and enhancer-like functions
Liao Liao 1, Guogui Ning 1, Caixian Liu, Wei Zhang, Manzhu Bao
Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, PR China
... 2.2. Sequence analysis. To predict the components of the FBP11 gene promoter and the first
intron in the 5?-UTR, the sequence was analyzed using SoftBerry FPROM programs, available
on the Softberry website (http://www.softberry.com) (Jens et al., 2008). ...
PloS one
September 12, 2013 DOI: 10.1371/journal.pone.0073920
Ets-2 Regulates Cell Apoptosis via the Akt Pathway, through the Regulation of Urothelial Cancer Associated 1, a Long Non-Coding RNA, in Bladder Cancer Cells
Wenjing Wu, Shuwan Zhang, Xu Li, Mei Xue, Sancheng Cao, Wei Chen
Clinical Laboratory, the First Affiliated Hospital, School of Medicine, Xi’an Jiaotong University, Xi’an, China
School of Medicine, Xi’an Jiaotong University, Xi’an, China, Clinical Laboratory, Xi’an Children’s Hospital, Xi’an, China
... The promoter and TSS predict tools include the FPROM program from Softberry software
(http://linux1.softberry.com/berry.phtml??topic=fprom&group=programs&subgroup=prom?oter)
and PromoterInspector program from genomatix (http://www.genomatix.de/online_help/help ...
Breast Cancer Research and Treatment
Volume 137, Issue 2 , pp 383-396 DOI:10.1007/s10549-012-2353-5
Vimentin DNA methylation predicts survival in breast cancer
Ulirsch et al.,
4. The University of North Carolina at Chapel Hill School of Nursing, Lab 013, Carrington Hall, CB #7460, Chapel Hill, NC, 27599-7460, USA
2. Lineberger Comprehensive Cancer Center, University of North Carolina, 450 West Drive, Chapel Hill, 27599, USA
... We first custom designed the primers for an amplicon that included the core Vimentin
promoter (Fig. 1), as predicted by http://linux1.softberry.com/berry.phtml?topic=fprom&
group=programs&subgroup=promoter and http://www.cbs. ...
Hum. Mol. Genet.
(2013) doi: 10.1093/hmg/ddt116
Meta-Analysis of Genome-wide Association Studies in 5 cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error
Stambolian et al.,
1Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, USA
2Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health and National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, USA
... Promoter/enhancer prediction tools used included FPROM from Softberry (http://linux1.softberry.
com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), FirstEF from Cold Spring
Harbor Laboratory (http://rulai.cshl.org/tools/FirstEF/), Promoter 2.0 ...
Matrix Biology
Volume 31, Issues 7–8, September–October 2012, Pages 412–420 DOI: 10.1016/j.matbio.2012.08.002
Quantification of type II procollagen splice forms using alternative transcript-qPCR (AT-qPCR)
McAlinden et al.,
a Department of Orthopaedic Surgery, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States
b Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States
... Analysis of the Col2a1 gene for alternative promoter sequences with FPROM (http://linux1.softberry.
com/berry.phtml) revealed 12 potential alternative promoter sites, including a TATA box
(TATAAAGA) within exon 2, which could also contribute to transcript diversity. ...
BMC Evolutionary Biology
2012, 12:125
http://www.biomedcentral.com/1471-2148/12/125
Molecular evolution of a-kinase anchoring protein
(AKAP)-7: implications in comparative
PKA compartmentalization
Keven R Johnson 1 , Jessie Nicodemus-Johnson 2, Graeme K Carnegie 3 and Robert S Danziger1,4,5
1 Department of Medicine, University of Illinois at Chicago, Chicago, IL, USA
4 Jesse Brown VA Medical Center, Chicago, IL, USA
... To determine AKAP7 splice variant exon positions and gene structures, the AKAP7 genes of
human, rat, dog, opossum, zebrafish, lamprey, and ciona were analyzed using GENESCAN
[58] and Promoter 2.0 Prediction Server [59] FPROM (Softberry, Inc., Mt Kisco, NY) programs ...
Stem Cells Trans Med March
2012 vol. 1 no. 3 188-199 doi: 10.5966/sctm.2011-0005
Human Muller Glia with Stem Cell Characteristics Differentiate into Retinal Ganglion Cell (RGC) Precursors In Vitro and Partially Restore RGC Function In Vivo Following Transplantation
Shweta Singhal et al.,
Divisions of aOcular Biology and Therapeutics and
bVisual Neurosciences, NIHR BRC University College London Institute of Ophthalmology and Moorfields Eye Hospital, London, United Kingdom
.. species in this region were used to ascribe a 1.6-kb sequence upstream of the coding region
as a putative promoter region for the gene (supplemental online Table 1). This sequence was
then analyzed using the FPROM Human promoter prediction software (Softberry, Inc., Mt. ...
Gene Expression Patterns
Volume 11, Issues 1–2, January–February 2011, Pages 118–121 DOI: 10.1016/j.gep.2010.10.002,
Transgenic labeling of the zebrafish pronephric duct and tubules using a promoter from the enpep gene
Christoph Seiler a, Michael Pack a, b,
a Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA
b Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA
... We used the softberry FPROM program (http://softberry.com) to identify possible transcription
start sites. ... For promotor prediction we used softberry fprom (http://www.softberry.com/berry.
phtml?topic = fprom&group = programs&subgroup = promoter). ...
Gene
Volume 492, Issue 1, 15 January 2012, Pages 148–159 DOI: 10.1016/j.gene.2011.10.034
Identification and functional characterization of the human EXT1 promoter region
Jennes et al.,
a Department of Medical Genetics, University of Antwerp, Belgium
b Department of Medical Genetics and Skeletal Rare Diseases, Rizzoli Orthopedic Institute, Bologna, Italy
... In silico analysis of the 10 kb upstream region of the EXT1 start codon (region [-10,000_- 1])
(transcript NM_000127.2) was performed with several promoter prediction programs using different
algorithms: BDGP (http://www.fruitfly.org/), FPROM (http://softberry.com/), Promoter ...
Archives of Virology
Volume 156, Issue 6 , pp 1097-1100 DOI: 10.1007/s00705-011-0971-6
Discovery of a genome of a distant relative of chicken anemia virus reveals a new member of the genus Gyrovirus
Rijsewijk et al.,
1. Virology Laboratory, Microbiology Department, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul (UFRGS), Av. Sarmento Leite 500, Porto Alegre, Rio Grande do Sul (RS), CEP 90050-170, Brazil
2. Institute for Veterinary Research “Desiderio Finamor” (IPVDF), Estrada do Conde 6000, Eldorado do Sul, Rio Grande do Sul (RS), CEP 92990-000, Brazil
... Cold Spring Harbour Laboratory Press, New York 18. Schat KA (2009) Chicken anemia virus.
Curr Top Microbiol Immunol 331:151–183 19. SoftBerry FPROM program. http://www.softberry.
ru/berry.phtml? group=programs&subgroup=promoter&topic=fprom 20. ...
Archiv Tierzucht
54 (2011) 4, 430-438, ISSN 0003-9438
Polymorphic sites in the 5?-region of the porcine C8A gene
D? Vo Anh Khoa 1,2, Siriluck Ponsuksili 1 , Eduard Murani 1 and Klaus Wimmers 1
1 Research Unit »Molecular Biology« Leibniz Institute for Farm Animals Biology (FBN), Dummerstorf, Germany,
2 Department of Animal Sciences, College of Agriculture and Applied Biology, Cantho University, Cantho City, Vietnam
... In silico analysis software The Neural Network Promoter Prediction http://www.fruitfly.org/
seq_ tools/promoter.html and the FPROM software http://www.softberry.com were used to
identify the transcription start site (TSS) and TATA-box, respectively. ...
BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51
Identification of a novel temperature sensitive promoter in cho cells
Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria
2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria
... Computational analysis of this region was performed using several freely available online
prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/
berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...
Journal of Virology
December 2009, p. 12769-12778, Vol. 83, No. 24
The 5' Leader of the mRNA Encoding the Marek's Disease Virus Serotype 1 pp14 Protein Contains an Intronic Internal Ribosome Entry Site with Allosteric Properties
Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, United Kingdom,1 Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037
... Promoter prediction and validation. We used different web-based programs for promoter
predictions. These included the FPROM program (Softberry, Inc., Mt. Kisco, NY) and the Neural
Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...
J. Virol.
2009 doi:10.1128/JVI.01010-09
The 5' Leader of the mRNA encoding the MDV-1 pp14 protein contains an intronic IRES with allosteric properties
Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, UK; Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037, USA
... Promoter prediction and validation. We have used different web-based programs for promoter
predictions. 20 These included the FPROM program (http://www.softberry.ru/berry) and the Neural
Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...
Molecular Biotechnology
Volume 39, Number 2 / June 2008 pp. 135-139
Identification of CHO Endogenous Promoter Elements Based on a Genomic Library Approach
Jens Pontiller, Stefan Gross, Haruthai Thaisuchat, Friedemann Hesse and Wolfgang Ernst
... http://www. softberry.co m/berry.pht ml?topic=fprom&group =programs &subgroup
=promoter http://www .softberry. ... http://www .softberry. ...
Entomological Research
2008 Volume 38 Issue 1, Pages 77 - 86
On page(s): 50-53
Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella
Wael GAD, Jae Young CHOI, Yeon Ho JE and Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea
2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea
... Promoter components were predicted using SoftBerry fprom (http://softberry.com/berry.
phtml?topic=fpromgroup=helpsubgroup=promoter). Southern hybridization. ...
Bioinformatics and Biomedical Engineering, 2008. ICBBE 2008. The 2nd International Conference
Publication Date: 16-18 May 2008
On page(s): 50-53
Sequence Analysis in Vicinity of Type 2 Diabetes Related SNP rs7903146
Jiao Chuan-zhen et al.,
... C. Promoter predication and transcription binding sites identification The FPROM
program for Human promoter prediction on http://www.softberry.com server was ...
BMC Genomics
2007, 8:374doi:10.1186/1471-2164-8-374
MetaProm: a neural network based meta-predictor for alternative human promoter prediction
Junwen Wang, Lyle H Ungar, Hung Tseng and Sridhar Hannenhalli
Center for Bioinformatics, University of Pennsylvania, Philadelphia, PA 19104, USA
Department of Genetics, University of Pennsylvania, Philadelphia, PA 19104, USA
... In this paper, we evaluate the performances of current major promoter prediction programs (i.e., PSPA, FirstEF, McPromoter, DragonGSF,
DragonPF, and FProm) using 42,536 distinct human gene promoters on a genome-wide scale, and with emphasis on alternative promoters.
...
FProm: Human Promoter Prediction.
[http://www.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter.]
...
Genome Biology
2006, 7(Suppl 1):S10
Automatic annotation of eukaryotic genes, pseudogenes and promoters
Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA
... The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false
positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. ...
Genome Biology
2006, 7(Suppl 1):S3
Performance assessment of promoter predictions on ENCODE regions in the EGASP experimen
Bajic et al.,
South African National Bioinformatics Institute (SANBI), University of the Western Cape, Bellville 7535, South Africa
... threshold of +0.005. The program can be found at [45]. Fprom: Softberry
Pol-II promoter recognition approach. The task of finding ...
Molecular Ecology
(2016) 25, 1801–1811 doi: 10.1111/mec.13519
Evidence from pyrosequencing indicates that natural variation in animal personality is associated with DRD4 DNA methylation
Verhulst, E. C. et al.,
*Department of Animal Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB,
Wageningen, The Netherlands, †Department of Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW),
Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands
... A CGI motif was searched in the DRD4 genomic region (GenBank accession DQ006802)
using CpGFinder (Softberry, USA) with the base pair numbering set to 1 on the transcription
start site. ... 2016). This indirectly supports the interpretation that ...
Animal reproduction science
2015, 154, 95-104. doi:10.1016/j.anireprosci.2014.11.023
Sequence and regulation of the porcine FSHR gene promoter
Wu, W et al.,
Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
... Possible CpG islands were searched for using CpGfinder on Softberry
(http://linux1.softberry.com/berry.phtml), CpG Island Searcher (http://cpgislands.usc.
edu/) and MethPrimer (http://www.urogene.org/methprimer/index1.html). ...
Applied microbiology and biotechnology
2015, 99(19), 8199-8215. DOI: 10.1007/s00253-015-6639-5
A novel salt-tolerant chitobiosidase discovered by genetic screening of a metagenomic library derived from chitin-amended agricultural soil
Cretoiu, M. S., Berini, F., Kielak, A. M., Marinelli, F., van Elsas, J. D.
1. Department of Microbial Ecology, CEES, University of Groningen, Groningen, The Netherlands
2. Department of Marine Microbiology, Royal Netherlands Institute for Sea Research, Yerseke, The Netherlands
... Bacterial promoters were predicted using BProm (SoftBerry, http://?linux1.?softberry.?
com/?berry). ... 2010). Searches for G + C-rich islands were performed using CpGFinder
(SoftBerry; http://?linux1.?softberry.?com/?berry). ...
Gene
2014, 544(2), 165-176. DOI: 10.1016/j.gene.2014.04.062
Identification and characterization of a Sox2 homolog in the Japanese flounder Paralichthys olivaceus
Gao J. et al.,
a College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, China
b College of Marine Life Science, Ocean University of China, Laboratory of Biochemistry and Biomaterials, 5 Yushan Road, Qingdao 266003, China
... The presence of a CpG-rich region within the upstream region was analyzed using the
Softberry CpGFinder program (http://linux1.softberry.com/berry.phtml?topic=
cpgfinder&group=programs&subgroup=promoter). 2.5. Bisulfite sequencing. ...
Cellular and molecular neurobiology
2014, 34(5), 715-725. DOI:10.1007/s10571-014-0053-x
Identification, Cloning, and Functional Analysis of the TATA-Less Mouse FNDC5 Promoter During Neural Differentiation
Seifi T. et al.,
1. Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran
5. Department of Biology, Payame Noor University, P.O. Box 19395-4697, Tehran, Iran
2. Department of Cellular Biotechnology at Cell Science Research Center, ACECR, Royan Institute for Biotechnology, 816513-1378, Isfahan, Iran
... www.genomatix.de) (Sobocki et al. 2007). CG content was predicted and calculated
by CpG Island finder (http://linux1.softberry.com), CpG plot (http://www.
ebi.ac.uk/Tools/emboss/cpgplot). Approximately, 2 9 104 bp upstream ...
Biochemical and Biophysical Research Communications
Volume 438, Issue 1, 16 August 2013, Pages 54–60 DOI:10.1016/j.bbrc.2013.07.023
Differential DNA methylation patterns in the CD86 gene controls its constitutive expression in keratinocytes
M.A. Romero-Tlalolini, P. Chavez Olmos, Efrain Garrido
Department of Genetics and Molecular Biology, CINVESTAV-IPN, Mexico City, Mexico
... human CD86 genomic region (GenBank ID: 942) including the coding sequence, the promoter
and the upstream intergenic region was analyzed in silico using three different software programs:
Methyl Primer Express Software v1.0 (Applied Biosystems), Softberry CpG Finder ...
Gene
Volume 529, Issue 2, 25 October 2013, Pages 238–244 DOI:10.1016/j.gene.2013.07.102
Core promoter analysis of porcine Six1 gene and its regulation of the promoter activity by CpG methylation
Wu et al.,
a Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
b Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science, Huazhong Agricultural University, Wuhan, Hubei 430070, China
... sites. While, possible CpG islands were predicted using the program CpG finder
on Softberry (http://www.softberry.com/berry.phtml) and MethPrimer (http://www.
urogene.org/methprimer/index1.html). 2.3. Plasmids. To produce ...
Fish Physiology and Biochemistry
Volume 39, Issue 5 , pp 1153-1163 DOI:10.1007/s10695-013-9771-0
Identification of HIF-1a promoter and expression regulation of HIF-1a gene by LPS and hypoxia in zebrafish
Shasha Liu, Kecheng Zhu, Nan Chen, Weimin Wang, Huanling Wang
1. Key Lab of Freshwater Animal Breeding, Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Fishery, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... 72 °C for 8 min. The PCR product was cloned into pGEM-T Easy vector (Promega,
Germany) and sequenced. The CpG island was predicted by CpG finder
(http://linux1.softberry.com/berry.phtml). To identify putative cis-acting ...
Molecular Biology Reports
June 2012, Volume 39, Issue 6, pp 6449-6465 doi: 10.3389/fmicb.2012.00185
Molecular analysis of a sunflower gene encoding an homologous of the B subunit of a CAAT binding factor
Salvini et al.,
1. Scuola Normale Superiore, Piazza dei Cavalieri 7, 56126, Pisa, Italy
2. Dipartimento di Biologia delle Piante Agrarie, Sezione di Genetica, Universita di Pisa, Via Matteotti 1B, 56124, Pisa, Italy
... The sequence of the intergenic DNA fragment spanning from the start codon of the HaL1L coding
region back to the stop codon of the upstream gene was examined with ''CpG- finder'' software
available at the site http://www.softberry. com to look for CpG isles. ...
PLoS ONE
7(3): e32154. doi:10.1371/journal.pone.0032154
Isolation of a 97-kb Minimal Essential MHC B Locus from a New Reverse-4D BAC Library of the Golden Pheasant.
Ye Q, He K, Wu S-Y, Wan Q-H
The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education and State Conservation Center for Gene Resources of Endangered Wildlife, College of Life Sciences, Zhejiang University, Hangzhou, China
... CpG islands were elicited with Softberry CpGfinder (http://linux1.softberry.com/all.html),...
Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002
Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes
M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico
b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico
... Rho-independent bacterial terminators were searched using the program FindTerm
(Softberry Inc.). ... Search for genomic islands was made using CpG finger program from
Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...
Asian-Aust. J. Anim. Sci.
Vol. 24, No. 4 : 463 - 470 April 2011
Single Nucleotide Polymorphisms of the GnRHR Gene Associated with Reproductive Traits of Japanese Flounder (Paralichthys olivaceus)
He et al.,
Fisheries College, Ocean University of China, Qingdao 266003, China
... 2001). In this study, the consensus GnRHR sequence was analyzed for the presence
of a CpG Island using Soft berry CpG Finder (http://www.softberry.com/berry.phtml?
topic=cpgfinder&gr oup=programs&subgroup=promoter). It ...
Molecular Biology Reports
Volume 38, Issue 4 , pp 2619-2632 DOI: 10.1007/s11033-010-0403-9
Molecular characterization, expression patterns and polymorphism analysis of porcine Six1 gene
W.Wu et al.,
1. Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture and Key Lab of Agriculture Animal Genetics, Breeding and Reproduction, Ministry of Education, Beijing, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... Proscan software, version 1.7 was used to predict the putative promoter and transcription factor
binding sites (http:// www-bimas.cit.nih.gov/molbio/proscan/). Possible CpG islands were searched
with the program CpG finder on Softberry (http://www.softberry.com/berry.phtml). ...
FEMS Microbiology Ecology
Volume 71, Issue 1, pages 23–33, January 2010
Phylogenetic and metagenomic analysis of Verrucomicrobia in former agricultural grassland soil
Kielak et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands
2 Arlington Department of Biology, University of Texas, Arlington, TX, USA
... Searches for GC islands were performed using CPGFINDER (SoftBerry, http://linux1.softberry.
com). For identification of potential HGT regions, the method described by Tamames & Moya
(2008) was applied to examine tetranu- cleotide frequencies. ...
Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10
Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6
Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2
...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the
GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC
islands were performed using CpGFinder (http://linux1.softberry.com). ... .
BMC Cancer
2008, 8:253 doi:10.1186/1471-2407-8-253
Promoter methylation inhibits BRD 7 expression in human nasopharyngeal carcinoma cells
H Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Changsha, Hunan, 410078, PR China
... CpGplot and Softberry CpGFinder, respectively. ... http://www.ebi.ac.uk/emboss/cpgplot)
program CpGplot and Softberry CpGFinder program Page 6. 5 ...
Molecular and Cellular Neuroscience
Volume 37, Issue 3, March 2008, Pages 537-547
Identification and characterization of the promoter region of the Nav1.7 voltage-gated sodium channel gene (SCN9A)
Diss et al.,
aMedical Molecular Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK
bMolecular Haematology and Cancer Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK
... This is not within a CpG island (EMBOSS CpG Plot, http://www.ebi.ac.uk/emboss/cpgplot/;
Softberry-CpGFinder, http://www.softberry.com/berry.phtml topic ...
Gene
Volume 384, 15 December 2006, Pages 62-72
Isolation and molecular characterization of the porcine transforming
growth factor beta type I receptor (TGFBR1) gene
Kefei Chen, Laurie A. Rund, Jonathan E. Beever and Lawrence B. Schooka
Department of Animal Sciences, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
Institute for Genomic Biology, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... com). Possible CpG islands were searched with the program CpGfinder on
Softberry (http://www.softberry.com/berry.phtml). Protein ...
Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology
Volume 141, Issue 4, August 2005, Pages 406-411
Analysis of CpG methylation in the killifish CYP1A promoter
Alicia R. Timme-Laragy a, Joel N. Meyer a, Robert A. Waterland b and Richard T. Di Giulio
aNicholas School of the Environment and Earth Sciences/Integrated Toxicology Program, Box 90328, Duke University, Durham, NC, USA
bDepartments of Pediatrics and Molecular and Human Genetics, Baylor College of Medicine, USDA Children's Nutrition Research Center, Houston, TX, USA
... The consensus CYP1A promoter sequence was analyzed for the presence of a CpG Island
using Softberry CpGFinder (http://www.softberry.com/berry.phtml?topic ...
Gene
Volume 340, Issue 1, 29 September 2004, Pages 19-30
Isolation and molecular characterization of the porcine stearoyl-CoA desaturase gene
Jun Ren a, b, Christoph Knorr a, Lusheng Huang b and Bertram Brenig
a Institute of Veterinary Medicine, Georg-August-University of Go"ttingen, Groner Landstrasse 2, Go"ttingen 37073, Germany
b Jiangxi Provincial Key Laboratory for Animal Biotechnology, Jiangxi Agricultural University, Nanchang 330045, PR China
... com). Possible CpG islands were searched with the program CpGfinder on
Softberry (http://www.softberry.com/berry.phtml). Repetitive ...
BMC Veterinary Research
2016, 12(1), p.287. DOI: 10.1186/s12917-016-0902-6
A deep sequencing reveals significant diversity among dominant variants and evolutionary dynamics of avian leukosis viruses in two infectious ecosystems
Meng, F. et al.,
College of Veterinary Medicine, Shandong Agricultural University; Institute of Pathogen Biology, Taishan Medical College
... Transcriptional regulatory elements in the U3 region were analyzed by the online service system
of NSITE (Recognition of Regulatory motifs) of SoftBerry (http://www.softberry.com/berry.phtml).
The statistical analysis was done by Duncan's multiple range test. ...
Biosci. Rep.
(2016) / 36 / art:e00293 / doi 10.1042/BSR20150290
Interrupted E2F1-miR-34c-SCF negative feedback
loop by hyper-methylation promotes colorectal
cancer cell proliferation
Yang S. et al.,
*Department of Histology and Embryology, School of Basic Medical Sciences, Capital Medical University, Beijing 100069, P.R. China
†Beijing Key Laboratory of Cancer Invasion and Metastasis Research, Beijing 100069, P.R. China
... Prediction of transcription
factors for miR-34c was conducted using TFSearch (http://
www.cbrc.jp/research/db/TFSEARCH.html), NSite (http://
linux1.softberry.com/) and Alggen (http://alggen.lsi.upc.
edu/). CpG island was predicted by EMBOSS Cpgplot
(http://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/). ...
Journal of cellular physiology
2016 DOI: 10.1002/jcp.25391
Atp2c2 Is Transcribed From a Unique Transcriptional Start Site in Mouse Pancreatic Acinar Cells
Fenech, M. A. et al.,
1 Children''s Health Research Institute, London, Ontario, Canada
2 Department of Pediatrics, University of Western Ontario, London, Ontario, Canada
... In all cases, n = 3. Download figure to PowerPoint. The region upstream of the Atp2c2c TSS
was examined for putative transcription factor binding motifs using the Alibaba-Gene
Regulation Data Base and Nsite—softberry (http://www.softberry.com). ...
Journal of Thoracic Oncology
2016 DOI: http://dx.doi.org/10.1016/j.jtho.2016.05.010
ITPKA gene body methylation regulates gene expression and serves as an early diagnostic marker in lung and other cancers
Wang, Y. W. et al.,
Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX, USA
The Center for Systems Biology, Department of Molecular and Cell Biology, The University of Texas at Dallas, Richardson, TX, USA
... binding motifs present in both ITPKA promoter and CpG island-2 regions. Using the Softberry
NSITE Program (http://www.softberry.com), we identified putative binding motifs for SP1 in
the promoter (nts -89 to -140) as well as CpG island-2 (motif 1 nts ...
Bioinformatics
2015, btv404. doi: 10.1093/bioinformatics/btv404
Nsite, NsiteH and NsiteM computer tools for studying transcription regulatory elements
Shahmuradov, I. A., & Solovyev, V. V.
1Computer, Electrical and Mathematical Sciences and Engineering Division, KAUST, Thuwal 23955-6900, KSA,
2Bioinformatics laboratory, Institute of Botany, ANAS, Baku AZ1073, Azerbaijan and
3Bioinformatics Division, Softberry Inc., Mount Kisco, NY 10549, USA
... Availability and implementation: Pre-compiled executables built under commonly used
operating systems are available for download by visiting http://www.molquest.kaust.edu.
sa and http://www.softberry.com. Contact: solovictor{at}gmail.com. ...
Brain Pathology
2015 DOI: 10.1111/bpa.12294
Role of microRNAs Located on Chromosome Arm 10q in Malignant Gliomas
Wolter, M., Werner, T., Malzkorn, B., Reifenberger, G.
1 Department of Neuropathology, Heinrich Heine University, Dusseldorf, Germany
2 German Cancer Consortium (DKTK), Partner Site Essen/Dusseldorf, German Cancer Research Center (DKFZ), Heidelberg, Germany
... In the 5'genomic region of miR-146b-5p, we investigated methylation patterns in and around
three putative SP1 transcription factor-binding sites predicted by the NSITE program (Version
2.2004, Softberry Inc., http://linux1.softberry.com/cgi-bin/programs/promoter/nsite.pl). ...
Physiology and Molecular Biology of Plants
2015, Volume 21, Issue 4 , pp 465-478 DOI: 10.1007/s12298-015-0325-z
Identification and expression analyses of MYB and WRKY transcription factor genes in Papaver somniferum L
Tayebeh Kakeshpour, Shadi Nayebi, Sajad Rashidi Monfared , Ahmad Moieni, Ghasem Karimzadeh
1. Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran
... 1999) and Soft Berry (NSITE) (Solovyev et al. ... As a result of TFBSs identification obtained using
the TRANSFAC, PLACE and SoftBerry databases, multiple unique TFBSs of many known TFs
in the promoter regions of these 10 co-expressed genes were found (Table 4). WRKY ...
Am J Respir Crit Care Med
2014 , 189, A2026. DOI:
Redox Regulation Of Ap-1 At Three Response Elements Is Required For Transforming Growth Factor-
Ryan, A. J., Carter, A. B., & Khan, M. T.
... Four potential AP-1 recognition sites in the 3' region of the TGF-? promoter were
identified with the Softberry NSITE: M1 (-407 -> -405), M2 (-369 -> -367), M3 (+160 ->
+162), M4 (+256 -> +258) with respect to transcription start site. ...
Virus genes
2014, 1-9. DOI: 10.1007/s11262-014-1081-9
Molecular characteristics of the complete genome of a J-subgroup avian leukosis virus strain isolated from Eurasian teal in China
Zeng X et al.,
1. College of Wildlife Resources, Northeast Forestry University, Harbin, 150040, China
2. Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute Chinese Academy of Agricultural Sciences, No. 427 Maduan St., Harbin, 150001, China
... Transcriptional regulatory elements in the U3 were analyzed with NSITE (Recognition of
Regulatory motifs) which is an online service of Soft Berry (http://?linux1.?softberry.?com/?berry.?
phtml). The sequences obtained in this study have been submitted to GenBank. ...
Small Ruminant Research.
Volume 120, Issue 1, July 2014, Pages 20–26 DOI: 10.1016/j.smallrumres.2014.03.014
Genetic diversity of GH1 and LEP genes in Argentine llama ( Lama glama) populations
Daverio, M. S., Lorenzo, Y., Rigalt, F., Vidal-Rioja, L., Di Rocco, F.
a Laboratorio de Genetica Molecular, Instituto Multidisciplinario de Biologia Celular (IMBICE), CCT-CONICET-La Plata, CICPBA, Calle 526 e/10 y 11, PO Box 403, La Plata 1900, Buenos Aires, Argentina
b INTA-Estacion Experimental Agropecuaria Catamarca, Ruta Provincial N° 33km 4 (4705), Sumalao, Valle Viejo, Catamarca, Argentina
... impact of amino acid substitutions on protein function was performed by using SIFT software
(http://sift.jcvi.org/) whereas the analysis of putative Transcription Factor Binding Sites (TFBS)
within the GH1 promoter gene was done with the NSITE program at Softberry site (http ...
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
2014, 169, 16-24. DOI: 10.1016/j.cbpb.2013.12.002
Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, Oncorhynchus mykiss
Mennigen J. A. et al.,
INRA, UR 1067, Nutrition, Metabolisme, Aquaculture, Aquapole, F-64310 Saint-Pee-sur-Nivelle, France
... Target sequences including a 2000 bp upstream sequence were retrieved and
transcription factor binding sites predicted using the NSITE software package Version
2.2004 (www.http://linux1.softberry.com/berry.phtml, Softberry Inc.). ...
PloS one
November 11, 2013DOI: 10.1371/journal.pone.0079307
Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds
Yang et al.,
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China, Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted and
identified with SoftBerry-NSITE/Recognition of Regulatory motifs(http://www.softberry.ru/berry.
phtml?topi?c=nsite&group=programs&subgroup=promoter). ...
Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI:10.1007/s11010-012-1522-5
Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene
Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml?
topic=nsite and group = programs and subgroup = promoter), and Promoter Scan
(http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...
Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019
Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress
Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland
b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium
... software. The cis-acting elements were determined with the use of TSSP,
NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol-
tools.ca/Promoters.htm). Measurements of ethylene production. The ...
PloS one
December 31, 2013DOI: 10.1371/journal.pone.0083392
UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes
Kraemer et al.,
Institute of Radiation Biology, Helmholtz Center Munich, Neuherberg, Germany
Department Molecular Cell Biology, Center of Dermatology, Elbekliniken Stade/Buxtehude, Buxtehude, Germany
... Primers used are given in Table S2. Prediction of potential regulatory elements using the NSITE
program. Potential regulatory elements in the promoter region (1500 bp) of the miRNAs commonly
regulated by UVA and UVB were identified using the NSITE program (Softberry,. ...
The Plant Cell
September 2013 vol. 25 no. 9 3389-3404 DOI:10.?1105/?tpc.?113.?114736
Arabidopsis KINETOCHORE NULL2 Is an Upstream Component for Centromeric Histone H3 Variant cenH3 Deposition at Centromeres[
Lermontova et al.,
aLeibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany
bInterdisciplinary Center for Crop Plant Research, Martin Luther University Halle-Wittenberg, D\x{2013}06120 Halle (Saale), Germany
... To see whether KNL2 is similarly regulated, the KNL2 promoter region was studied in silico using
the NSITE program (available through www.softberry.com/berry.phtml?topic=promoter). A potential
E2F binding site (CCCGCCAAA) was found at ?148 bp upstream of ATG. ...
PloS pathogenes
August 29, 2013DOI: 10.1371/journal.ppat.1003571
Schistosoma mansoni Mucin Gene (SmPoMuc) Expression: Epigenetic Control to Shape Adaptation to a New Host
Perrin et al.,
Universite de Perpignan Via Domitia, Perpignan, France, CNRS, UMR 5244, Ecologie et Evolution des Interactions (2EI), Perpignan, France
Center for Infection and Immunity of Lille, Inserm U1019, CNRS UMR 8204, Institut Pasteur de Lille, University Lille Nord de France, Lille, France
...We scanned the promoter sequences for putative regulator binding sites using the web based interface Program NSITE (Softberry Inc.) (http://linux1.softberry.com/berry.phtml??topic=nsite&group=programs&subgroup=prom?oter).þþþ
Scientific Reports
3, Article number: 2178 doi:10.1038/srep02178
Hox genes are involved in vascular wall-resident multipotent stem cell differentiation into smooth muscle cells
Diana Klein, Mohamed Benchellal, Veronika Kleff, Heinz Gunther Jakob & Suleyman Ergun
Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany
Institute of Anatomy, University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany
...Chromosome 11: 117,070,037-117,075,503 forward strand) was analyzed for promoter prediction sites using the Promotor 2.0
prediction server (www.cbs.dtu.dk/services/Promoter/) and SoftBerry NSITE (http://linux1.softberry.com)...
Forest Pathology
6 NOV 2012 DOI: 10.1111/efp.12011 Early View (Online Version of Record published before inclusion in an issue)
Characterization and expression of daf-9 and daf-12 genes in the pinewood nematode, Bursaphelenchus xylophilus
D.-D. Wang 1,2,
X.-Y. Cheng 3,*,
Y.-S. Wang 2,
H.-Y. Pan 1,
B.-Y. Xie 2
1
College of Plant Science, Jilin university, Changchun, China
2
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing, China
... nested PCR. The PCR products were purified, cloned and sequenced. The sequences
were analysed using NSITE (http://linux1.softberry.com/berry.phtml?topic=nsite&group=
programs&subgroup=promoter). 2.5 Gene expression ...
JCB
March 19, 2012 vol. 196 no. 6 689-698 DOI: 10.1083/jcb.201201077
MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response
Andrew E. Byrd, Ileana V. Aragon, and Joseph W. Brewer
Department of Microbiology and Immunology, College of Medicine, University of South Alabama, Mobile, AL 36688
... Potential transcription factor binding sites upstream of the miR-30c-2* chromosomal location
were identified using the NSITE program (Softberry) and the University of California, Santa
Cruz Genome browser. Reporter and expression vectors. ...
Molecular Genetics and Metabolism
Volume 106, Issue 3, July 2012, Pages 281–286 DOI: 10.1016/j.ymgme.2012.04.013,
Algorithm for Pompe disease newborn screening: Results from the Taiwan screening program
Shu-Chuan Chiang a, Wuh-Liang Hwu a, b, Ni-Chung Lee a, b, Li-Wen Hsu a, Yin-Hsiu Chien a, b
a Department of Medical Genetics, National Taiwan University Hospital, Taipei, Taiwan
b Department of Pediatrics, National Taiwan University Hospital and National Taiwan University School of Medicine, Taipei, Taiwan
... upon request). The promoter regions (? 500 bp) of the GAA and neutral ?-glucosidase
C (GANC) genes were analyzed by the NSITE program (available at http://www.
softberry.com/berry.phtml). 2.3. Statistical analysis. A single ...
PLoS ONE
7(10): e48097. doi:10.1371/journal.pone.0048097
How Peroxisomes Affect Aflatoxin Biosynthesis in Aspergillus Flavus
Reverberi et al.,
Dipartimento di Biologia Ambientale, Universita Sapienza, Roma, Italy
Oklahoma State University, Oklahoma City, Oklahoma, United States of America
... present in the 2.0 Kb 5' Flanking sequence (upstream) of AFLA099000, retrieved from
http://fungi.ensembl.org/Aspergillus_fla?vus/Info/Index, was performed with the genomic tools
in the aspergillusflavus.org website and through the NSITE tool in the softberry.com website and ...
Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI: 10.1007/s11010-012-1522-5
Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene
Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml?
topic=nsite and group = programs and subgroup = promoter), and Promoter Scan
(http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...
African Journal of Biotechnology
Vol. 11 (31), pp. 7864-7874, 17 April, 2012
DOI: 10.5897/AJB11.1229
The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome
Handeng Liu 1,2, Guoqing Pan 1*, Tian Li 1, Wei Huang 1 and Zeyang Zhou 1,3,
1Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, P.R. China.
2Experimental Teaching Center, Chongqing Medical University, Chongqing 400016, P.R. China.
... from the initiation site of the predicted transcription start site (TSS, +1). The regions 500 bps
upstream from the transcription initiation site were used for analyzing the potential binding sites
for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...
Plant Science
Volumes 193–194, September 2012, Pages 39–47 http://dx.doi.org/10.1016/j.plantsci.2012.05.005
The regulation of the SARK promoter activity by hormones and environmental signals
Carla A. Delatorre a, b, 1,
Yuval Cohen a, c, 1,
Li Liu a, 1,
Zvi Peleg a, 2,
a Department of Plant Sciences, University of California, Davis, CA 95616, USA
b Department of Crop Science, Agronomy School, Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS, 91501970, Brazil
... To identify cis-regulatory elements in the promoter, cis-element search programs at PLACE
(http://www.dna.affrc.go.jp/PLACE/info.html, PlantCARE (http://bioinformatics.psb.ugent.be/
webtools/plantcare/html/), and NSITE (http://linux1.softberry.com/cgi-bin/programs/promoter ...
Sci. Signal.
18 January 2011 Vol. 4, Issue 156, p. ra2 [DOI: 10.1126/scisignal.2001211]
The Kinase SGK1 in the Endoderm and Mesoderm Promotes Ectodermal Survival by Down-Regulating Components of the Death-Inducing Signaling Complex. Sci. Signal. 4, ra2 (2011).
T. Endo, M. Kusakabe, K. Sunadome, T. Yamamoto, E. Nishida
... Cis-regulatory elements in the promoter regions were searched with TRANSFAC (41) and
NSITE (http://linux1.softberry.com/berry.phtml). ChIP. ChIP was performed as described (42).
Fifty embryos were injected with HA-xRelA mRNA at four-cell stage. ...
Virology Journal
2011, 8:158
http://www.virologyj.com/content/8/1/158
Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3’UTR
Shi et al.,
1 College of Veterinary Medicine, Sichuan Agricultural University, Ya’an,
Sichuan, 625014, China
... DNASTAR package. Transcriptional regulatory elements in U3 were analyzed by
the online service system of NSITE (Recog- nition of Regulatory motifs) of SoftBerry
(http://linux1. softberry.com/berry.phtml). Phylogenetic analysis ...
Virology Journal
2011, 8:552 http://www.virologyj.com/content/8/1/552
Novel sequences of subgroup J avian leukosis viruses associated with hemangioma in Chinese layer hens
Pan et al.,
1
Division of Avian Infectious Diseases, State Key Laboratory of Veterinary
Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of
Agricultural Sciences, Harbin 150001, PR China
... Bootstrap values were calculated using 500 or 1000 replicates of the alignment. Transcriptional
regulatory elements in the U3 were ana- lyzed by NSITE (Recognition of Regulatory motifs),
an online service of Soft Berry (http://linux1.softberry.com/ berry.phtml). ...
Genetics and Molecular Research
10 (3): 1777-1786 (2011) DOI: 10.4238/vol10-3gmr1466.
Molecular cloning, characterization and association analysis of the promoter region of the bovine CDK6 gene
Liu YF, Zan LS, Cui WT, Xin YP, Jiao Y, Li K.
College of Animal Science and Technology, Northwest Agriculture and Forestry University, Yangling Shaanxi, PR China.
... were analyzed using Cat- tle dbSNP (http://www.ncbi.nlm.nih.gov/snp/limits), Transcription Element
Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), Promoter Scan (http://www.bimas.
cit.nih.gov/ molbio/proscan), and the NSITE program (Softberry, http://linux1 ...
Mol Cancer Res
April 2011 9; 497 doi: 10.1158/1541-7786.MCR-10-0556
Expression Regulation of the Metastasis-Promoting Protein InsP3-Kinase-A in Tumor Cells
Chang et al.,
1Institut fur Biochemie und Molekularbiologie I: Zellulare Signaltransduktion; 2Institut fur Tumorbiologie, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany
... transcription factors was investigated. Therefore, transcription factor binding sites
in ITPKA-1250 were analyzed by a Softberry NSITE motif search (core similarity 0.8,
significance level 0.95) motif search. Potential binding sites ...
Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126–3137 DOI: 10.1016/j.biortech.2010.10.079
Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes
Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
Journal of Hazardous Materials
Volume 192, Issue 2, 30 August 2011, Pages 855–873 DOI: 10.1016/j.jhazmat.2011.05.106,
Decolorization of different dyes by a newly isolated white-rot fungi strain Ganoderma sp.En3 and cloning and functional analysis of its laccase gene
Rui Zhuo et al.,
a Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
Cellular and Molecular Life Sciences
Volume 68, Issue 24 , pp 4115-4132 DOI: 10.1007/s00018-011-0785-4
Functional diversity of melanopsins and their global expression in the teleost retina
Davies et al.,
1. Nuffield Laboratory of Ophthalmology, Nuffield Department of Clinical Neurosciences, Levels 5-6 West Wing, John Radcliffe Hospital, University of Oxford, Headley Way, Oxford, OX3 9DU, UK
2. Department of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, 21 University Street, London, WC1E 6DE, UK
... gene were performed by using the MatrixTM Version 1.0 database (with a cut- off filter to minimize
false positives) (http://www.gene- regulation.com/cgi-bin/pub/programs/match/bin/match.cgi)
and NSITE: Animal TFD from Ghosh database (http:// linux1.softberry.com/berry.phtml ...
Applied Microbiology and Biotechnology
2011, Volume 91, Issue 4 , pp 1107-1119 DOI: 10.1007/s00253-011-3355-7
PdCYP51B, a new putative sterol 14?-demethylase gene of Penicillium digitatum involved in resistance to imazalil and other fungicides inhibiting ergosterol synthesis
Xuepeng Sun, Jiye Wang, Dan Feng, Zhonghua Ma, Hongye Li
1. Institute of Biotechnology, Zhejiang University, Hangzhou, Zhejiang, 310029, China
2. Key Laboratory of Molecular Biology for Crop Pathogens and Insect Pests of Ministry of Agriculture, Zhejiang University, Hangzhou, Zhejiang, 310029, China
... The NSITE program (www.softberry.com) and the eukaryotic promoter predictor (Berkeley
Drosophila Genome Project, http://www.fruitfly.org/seq_tools/promoter.html) were used to
analyze the sequence of PdCYP51B gene. The protein ... softberry.com). ...
Scandinavian Journal of Rheumatology
May 2010, Vol. 39, No. 3 , Pages 254-258 (doi:10.3109/03009740903347983)
Association of TBX21 gene haplotypes in a Chinese population with systemic lupus erythematosus
You et al.,
1Department of Dermatology
2Department of Paediatrics
3Department of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing, P. R. China
... (A) Computer analysis of sequences covering -1993 bp, by using NSITE (http://linux1.softberry.
com/berry.phtml?topic = nsite&group =programs&subgroup = promoter), indicated that the
-1993T>C SNP is located on a putative binding site for the Sp1 transcription factor. ...
Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126-3137, doi:10.1016/j.biortech.2010.10.079
Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes
Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
The Journal of Physiological Sciences
Volume 59, Number 2 / March, 2009, pp. 81-86
Association of Ala589Ser polymorphism of WNK4 gene with essential hypertension in a high-risk Chinese population
Sun et al.,
(1) Department of Medical Genetics, China Medical University, Shenyang, 110001, China
(2) Department of Cardiology, Shengjing Hospital, China Medical University, Shenyang, 110004, China
... 2). Using software including TRANSFAC 4.0 (avail- able at http://transfac.gbf.de/TRANSFAC/),
TSSG/TSSH (available at http://www.cbs.dtu.dk/services/Promoter/) and NSITE (available at
http://www.softberry.com/berry.phtml), a number of cis-acting elements, eg, AP1, SP1, GRE ...
Gene
Volume 435, Issues 1-2, 15 April 2009, Pages 63-71
Characterization of porcine MMP-2 and its association with immune traits
Honggang Huang et al.,
aKey Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, PR China
... The 5?-?anking DNA sequences were analyzed using the Transcription Element Search System
(http://www.cbil.upenn.edu/cgi-bin/tess/tess), the NSITE program (http://linux1.softberry.com/berry.
phtml?topic=nsite and group=programs and subgroup=promoter), and the ...
Meat Science
Volume 82, Issue 2, June 2009, Pages 278-283
Identification of the new polymorphisms in the promoter region of the CAST gene in cattle
E. Juszczuk-Kubiak a, E, K. Flisikowski b, K. Wicin'ska a, J. Po?oszynowicza and S. Rosochacki a, c
aInstitute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrze;biec, 05-552 Wo'lka Kosowska, Poland
bLehrstuhl fuer Tierzucht Technische Universitat in Muenchen, 85354 Hochfeldweg 1, Freising, Germany
... Sequences with 100% identity to TF-binding sites were searched in the NSITE program
(Softberry, Inc., USA, http://www.softberry.com) and TESS software (Schug J & Overton,
Ch.G.; http://www.cbil.upenn.edu/tess). 3. Results and discussion. ...
Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90
Characterization of the murine Dfna5 promoter and regulatory regions
Karen Vrijens a, Guy Van Camp a and Lut Van Laer a
aDepartment of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium
... Transcription factor (TF) binding sites were scored using three programs, MatInspector
(www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www-bimas.cit.nih.gov/
molbio/proscan/). 2.2. 5?- and 3?-rapid amplification of cDNA ends (RACE). ...
BMC Molecular Biology
2008, 9:104 doi:10.1186/1471-2199-9-104
The artiodactyl APOBEC3 innate immune repertoire shows evidence for a
multi-functional domain organization that existed in the ancestor of placental
mammals
LaRue et al.,
Department of Biochemistry, Molecular Biology and Biophysics, Institute for Molecular
Virology,BeckmanCenter for Genome Engineering,University of Minnesota,Minneapolis,
Minnesota 55455,USA
... were identified and compared using the TransFac and Biobase databases through
the softberry NSITE portal (www.softberry.com). The ...
Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90
Characterization of the murine Dfna5 promoter and regulatory regions
Karen Vrijens, Guy Van Camp and Lut Van Laer
Department of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium
... Transcription factor (TF) binding sites were scored using three programs, MatInspector
(www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www ...
Eukaryotic Cell
June 2008, p. 988-1000, Vol. 7, No. 6 doi:10.1128/EC.00228-07
Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA Gene{triangledown}
Reverberi, M et al.,
... This analysis was performed using the NSITE tool in the Softberry software package,
which allowed us to reveal all of the putative regulatory elements present ...
International Journal of Plant Sciences
169(6):701–707. 2008.
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
Sabina Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana, Slovenia
... Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...
Signal Scan program and the REGSITE database with the NSITE program, several ...
DNA and Cell Biology
June 1, 2008, 27(6): 307-314. doi:10.1089/dna.2007.0692
Identification and Characterization of the Human Testes-Specific Protease 50 Gene Promoter
M. Wang et al.,
Institute of Genetics and Cytology, Northeast Normal University, ChangChun, China.
.. MatInspector(Carthariusetal.,2005) (http:==www.genomatix.de=cgi-bin=matinspector_prof),
and NSITE (Solovyev and Shahmuradov, 2006) (http:==www .softberry.com). ..
Plant Pathology
57(1):92-102, February 2008.
A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.
Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software
PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...
J Appl Genet
48(4), 2007, pp. 371–374
Polymorphisms in intron 1 of the porcine POU1F1 gene
Cheng-Yi Song et al.,
College of Animal Science & Technology, Yangzhou University, Jiangsu, China;
Division of Biological Sciences, University of Missouri-Columbia, Columbia, MO, USA
... the potential functional importance of the 313-bp indel, the insertion sequences
were analysed in silico and by the use of NSITE pro- gram (Softberry, Inc, USA ...
Molecular Microbiology
(2007), 66 (2), 534–551
Transcriptional control of nmrA by the bZIP transcription factor MeaB reveals a new level of nitrogen
regulation in Aspergillus nidulans
Koon Ho Wong, Michael J. Hynes, Richard B. Todd, Meryl A. Davis
Department of Genetics, The University of Melbourne, Melbourne, Vic. 3010, Australia
... Analysis using the NSITE algorithm (http://www.softberry.com) matched both element
A and B sequences independently to the binding site of the mammalian bZIP ...
Epilepsy Research
Volume 75, Issue 2-3, Pages 145-153
Linkage and mutational analysis of CLCN2 in childhood absence epilepsy
K Everett et al.,
... using the prediction program ESEfinder version 2.0 (Cartegni et al., 2003) and the
TransFac and Biobase GmbH databases via NSITE (http://www.softberry.com). ...
RNA
(2007), 13:1988-1999
Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing
Moti Alberstein et al.,
Department of Human Molecular Genetics and Biochemistry, Sackler Faculty of Medicine, Tel-Aviv University, Tel Aviv 69978, Israel
... programs: TRANSPLORER (http://www.developmentontheedge.com/transplorer.shtml);
Genomatix (http://www.genomatix.de/); NSITE (http://www.softberry.com/berry.phtml ...
European Journal of Human Genetics
15, 463 - 472 (01 Apr 2007)
Linkage and association analysis of CACNG3 in childhood absence epilepsy
KV Everett et al.,
... identified variants was assessed by searching for predicted regulatory motifs contained
within the TransFac and Biobase databases via the Softberry NSITE portal ...
Insect Science
Volume 14 Issue 1 Page 5-14, February 2007
Analysis of the structure and expression of the 30K protein genes in silkworm,
Bombyx mori
QUAN SUN et al.,
The Key Laboratory of Sericulture of Agriculture Ministry, College of Sericulture and Biotechnology, Southwest University, Chongqing, China
... initiation site were used for analyzing the potential binding sites for the
transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...
Mammalian Genome
Volume 17, Number 8 / August, 2006 pp. 892-901
Identification of genetic variation and putative regulatory regions in bovine CARD15
Kristen H. Taylor, Jeremy F. Taylor, Stephen N. White and James E. Womack
Department of Veterinary Pathobiology, Texas A&M University, College Station, Texas, 77843-4467, USA
... These motifs were analyzed using NSITE (available through SoftBerry, http://www.
softberry.com/berry.phtml?topic=pro- moter) to determine homology to previously ...
Human Genetics
Volume 117, Number 1 / June 2005 pp. 16-26
Functional promoter polymorphism in the TBX21 gene associated with aspirin-induced asthma
Mitsuteru Akahoshi et al.,
Laboratory for Genetics of Allergic Diseases, SNP Research Center, RIKEN Yokohama Institute, Institute of Physical and Chemical Research (RIKEN), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama Kanagawa, 230-0045, Japan
... shown). Computer analysis of sequences covering A1993 bp, by using NSITE,
available at http://www.softberry.com/berry.phtml? topic ...
Frontiers in Plant Science
2016, 7: 2034. doi: 10.3389/fpls.2016.02034
Comparative Analysis of WRKY Genes Potentially Involved in Salt Stress Responses in Triticum turgidum L. ssp. durum
Yousfi et al.,
1 Laboratory of Plant Molecular Physiology, Center of Biotechnology of Borj Cedria, Borj Cedria Science and Technology Park, Hammam-lif, Tunisia
2 Centre National de Ressources Genomiques Vegetales, French Plant Genomic Center, INRA–CNRGV, Castanet-Tolosan, France
3 INRA, UMR990 Genomique et Biotechnologie des Fruits, Castanet-Tolosan, France
... A 1.5 kb DNA fragment on the 5?-regulatory region upstream of the transcription start of the
TdWRKY gene was subjected to in silico analysis using the PLACE signal scan and NSITE-PL
(Recognition of PLANT Regulatory motifs with statistics) from the Softberry tool (http://www ...
Tree Genetics & Genomes
2016, 12(6), p.106. doi:10.1007/s11295-016-1066-z
Molecular characterization, critical amino acid identification, and promoter analysis of a lycopene b-cyclase gene from citrus
Lu, S. et al.,
Key Laboratory of Horticultural Plant Biology, Ministry of EducationHuazhong Agricultural UniversityWuhanChina
... amplification. The full-length promoters were obtained by sequence assembly.
Promoter regions and plant regulatory motifs were searched using the SoftBerry TSSP
and Nsite-PL program (http://linux1.softberry.com/). A search ...
Plant Production Science
2016, 19(4), pp.552-561. doi: 10.1080/1343943X.2016.1221320
Suppression subtractive hybridization library construction and identification of epidermal bladder cell related genes in the common ice plant, Mesembryanthemum crystallinum L
Roeurn, S. et al.,
... (2011). To search for their putative regulatory elements and binding motifs, the isolated
promoters were subject to NSITE-PL search analysis (Solovyev et al., 2010) using
the Softberry website (http://www.softberry.com/berry.phtml). ...
Plant Gene
2016, 5, 78-86. doi:10.1016/j.plgene.2016.01.001
Molecular cloning and transcriptional analysis of WRKY and solavetivone biosynthetic genes in the hairy roots of Hyoscyamus albus
Kawauchi, M., Arima, T. H., Kuroyanagi, M.
Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan
.. PLACE (http://www.dna.affrc.go.jp/PLACE/index.html) and NSITE-PL
(http://www.softberry.com/berry.phtml?topic=nsitep&group=programs&subgroup ...
Plant Physiology
September 2013 vol. 163 no. 1 431-440 DOI:10.?1104/?pp.?113.?221713
Histone Deacetylase AtHDA7 Is Required for Female Gametophyte and Embryo Development in Arabidopsis
Cigliano et al.,
National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, 80055 Portici, Italy (R.A.C., G.C., R.P., P.T., G.P., M.F.C., C.C.); and
Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, 1030 Vienna, Austria (R.G.)
... An area 1,000 bp upstream of the predicted start codon of HDA7 was analyzed with NSITE-PL
(http://linux1.softberry.com) and Akiyama's TFSEARCHv1.3 (http://molsun1.cbrc.aist.go.jp/research/
db/TFSEARCH.html) with default setting to detect putative regulatory motifs. ...
Plant Growth Regulation
Volume 71, Issue 1 , pp 77-92 DOI:10.1007/s10725-013-9814-7
A novel GRAS protein gene MtSymSCL1 plays a role in regulating nodule number in Medicago truncatula
Goon-Bo Kim, Young-Woo Nam
Sta1. Department of Life Science, Sogang University, Seoul, 121-742, Koreate
... 2008 ). The 5? upstream flanking region of MtSymSCL1 was analyzed by using the PLACE
database (Higo et al. 1999 ) or the RegSite database of plant regulatory elements (NSITE-PL
program, http://www.softberry.com). Construction of reporter fusion and RNAi plasmids. ...
Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019
Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress
Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland
b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium
... software. The cis-acting elements were determined with the use of TSSP,
NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol-
tools.ca/Promoters.htm). Measurements of ethylene production. The ...
Plant, Cell & Environment
2013, 36: 1171–1191. doi: 10.1111/pce.12051
Two closely linked tomato HKT coding genes are positional candidates for the major tomato QTL involved in Na+/K+ homeostasis
ASINS et al.,
1Plant Protection and Biotechnology Center, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain
2Department of Biochemistry, Molecular and Cellular Biology of Plants, Estacion Experimental del Zaidin, Consejo Superior de Investigaciones Cientificas (CSIC), Granada, Spain
3Center for Plant Biotechnology and Genomics (UPM-INIA), Universidad Politecnica de Madrid, Madrid, Spain
... 1999) and PlantCARE (Lescot et al. 2002) and NSITE-PL (http://linux1.softberry.com)
databases and tools. The presence of CpG islands was checked by the CpG Islands Searcher
web tool using the program's default settings (Takai & Jones 2002). ...
Plant Molecular Biology
Volume 82, Issue 1-2 , pp 51-58 DOI:10.1007/s11103-013-0034-3
Sugarcane Loading Stem Gene promoters drive transgene expression preferentially in the stem
Richard L. Moyle, Robert G. Birch
1. Hines Plant Science Building, The University of Queensland, Brisbane, 4072, Australia
... ScLSG promoters, by searching PLACE (Higo et al. 1999), PlantCARE (Lescot et
al. 2002), Athena (O'Connor et al. 2005) and NSITE-PL (www.softberry.com/berry.
phtml) databases. ScLSG5 Apex IN3 IN4 IN5 IN6 IN7 IN8 IN9 ...
Journal of Integrative Plant Biology
Volume 54, Issue 6, pages 400–411, June 2012 DOI: 10.1111/j.1744-7909.2012.01126.x
Characterization of Two Putative Protein Phosphatase Genes and Their Involvement in Phosphorus Efficiency in Phaseolus vulgaris
Cui-Yue Liang 1,2, Zhi-Jian Chen 1, Zhu-Fang Yao 1, Jiang Tian 1,*, Hong Liao 1
1 State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Root Biology Center, South China Agricultural University, Guangzhou 510642, China
2 Robert Holley Center for Agriculture and Health, United States Department of Agriculture, Agricultural Research Service, Cornell University, Ithaca, New York 14853, USA
... genomewalker DNA library derived from G19833 genomic DNA. Putative motifs regulated by
environmental stresses were identified by using the software NSITE-PL (www.softberry.com)
and PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan) in silico. Among them, two 8-bp ...
Plant Cell Reports
Volume 31, Issue 2 , pp 271-279 DOI
10.1007/s00299-011-1161-4
Native polyubiquitin promoter of rice provides increased constitutive expression in stable transgenic rice plants
Jagannath Bhattacharyya et al.,
1. Advanced Laboratory for Plant Genetic Engineering, Indian Institute of Technology, Kharagpur, 721302, India
... 2002; http://www.bioinformatics.psls.ugent.be/webtools/ PlantCARE/html/); Athena (O'Connor
et al. 2005; http://www.bioinformatics2.wsu.edu/Athena); NSITE-PL (Soft berry,
http://www.softberry.com/berry.phtml). Results Generation of transgenic rice lines ..
African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040
Isolation and characterization of a candidate gene for
resistance to cereal cyst nematode from Aegilops
variabilis in China
D. L. Xu et al.,
1
Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China.
2
Graduate University of the Chinese Academy of Sciences, Beijing, China.
... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the
amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed
using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...
The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x
A soybean
Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China
... accession number FJ461673). In silico analysis of the promoter sequence was
performed using the software programs tssp-tcm (Shahmuradov et al., 2005),
nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...
Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24
Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar
Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.
... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb.
ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry,
http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ...
Plant Cell Rep.
2009 May;28(5):851-60. Epub 2009 Mar 21.
43-bp A/T-rich element upstream of the kinesin gene AtKP1 promoter functions as a silencer in Arabidopsis
Lai C, Xiong J, Li X, Qin X.
College of Biological Sciences, China Agricultural University, Beijing, China
... 1999) and NSITE-PL (www.softberry.com) to ascertain whether the 180-bp sequence
has sequence similarity to other regulatory elements. We found that multiple previously
reported cis- elements were present in this region (Fig. ...
BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271
The evolution of Brassica napus FLOWERING LOCUST paralogues in
the context of inverted chromosomal duplication blocks
Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted
Research, Harpenden, Herts, AL5 2JQ, UK
... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted
using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ...
"Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...
Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394
Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar
Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China
... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as
UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to
predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...
Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065
Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)
Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece
... elements was performed using the database available at: http://softberry.com. TSSs
were determined using the TSSP program available at the site. NSITE-PL was ...
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
Plant Physiology
144:1786-1796 (2007)
Exclusion of Na+ via Sodium ATPase (PpENA1) Ensures Normal Growth of
Physcomitrella patens under Moderate Salt Stress
Christina Lunde, Damian P. Drew, Andrew K. Jacobs and Mark Tester
Plant Biochemistry Laboratory, Department of Plant Biology, Faculty of Life Sciences,
University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark (C.L.,); and Australian
Centre for Plant Functional Genomics, University of Adelaide, Waite Campus, Glen Osmond, South
Australia 5064, Australia (D.P.D., A.K.J., M.T.)
... obtained from the eight templates were aligned using Contig Express (Vector NTI
8). The promoter sequence was analyzed using NSITE-PL (www.softberry.com) and ...
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 2, February 2007, Pages 139-148
Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis
Nitima Suttipantaa, Sitakanta Pattanaika, Samir Gunjanc, Claire H. Xiea,John Littletonb, and Ling Yuana
Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546, USA
... 1). Sequence analysis using PLACE (www.dna.affrc.go.jp/PLACE) [14] and the
NSITE-PL program (www.softberry.com) reveals that the G10H promoter contains several ...
In Silico Biology
Volume 7, Number 1 / 2007 pp. 7-19
In silico analysis of the Lateral Organ Junction (loj) gene
and promoter of Arabidopsis thaliana
Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India
...The software programs used were AtcisDB (http://arabidopsis.med.ohio-state.edu/AtcisDB/index.jsp) [Davuluri et al., 2003] PLACE (http://www.dna.affrc.go.jp/PLACE/) [Higo et al., 1999], PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [Lescot et al., 2002], and NSITE-PL (Softberry; http://www.softberry.com/berry.phtml).
Similarly NSITE-PL of Softberry Inc. and PLACE database identified a large number of cis-elements, except few the majority of which may not be relevant for the function of this promoter.
...
Plant Molecular Biology
(2006) 60, 2, 259-275
Gene Structure and Expression Pattern Analysis of Three Monodehydroascorbate Reductase (Mdhar)
Genes in Physcomitrella patens: Implications for the Evolution of the MDHAR Family in Plants*
Christina Lunde , Ute Baumann, Neil J. Shirley, Damian P. Drew and Geoffrey B. Fincher
Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, Waite Campus, Glen Osmond, 5064, SA, Australia
... The promoter sequence was analysed using NSITE-PL (www.softberry.com), PLACE ...
The Plant Cell
Volume18 Number 10 October 2006 2443-2451
Loading of Arabidopsis Centromeric Histone CENH3 Occurs Mainly during G2 and Requires the Presence of the Histone Fold Domain
Inna Lermontova et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany
... Computer analysis of the presumed promoter region of A. thaliana CENH3, using the
NSITE program (available through SoftBerry, http://www.softberry.com/berry ...
Genes and Immunity
07 Aug 2008, doi: 10.1038/gene.2008.63,
Expression levels of FAS are regulated through an evolutionary conserved element in intron 2, which modulates cystic fibrosis disease severity
V Kumar et al.,
# 1Department of Pediatric Pneumology and Neonatology, Hannover Medical School, Hannover, Germany
# 2Institute for Medical Biometry, Informatics and Epidemiology, University of Bonn, Bonn, Germany
... Webthermodyn. 17 The program NSITEM at www.softberry.com was used to search
for conserved functional motifs within the CNS. Possible ...
BMC Genetics
2008, 9:50 doi:10.1186/1471-2156-9-50
Bovine CD14 gene characterization and relationship between
polymorphisms and surface expression on monocytes and
polymorphonuclear neutrophils
Eveline M Ibeagha-Awemu1 Jai-Wei Lee, Aloysius E Ibeagha1 and
Xin Zhao
1Department of Animal Science, McGill University, Ste-Anne-de-Bellevue, Quebec H9X 3V9, Canada and 2Department of Tropical
Agriculture and International Cooperation, National Pingtung University of Science and Technology, Neipu, Pingtung 912, Taiwan
... of the CD14 genes of different species (cattle, human, mouse, rat and pig) through
a query in the NSITEM data base http:/ / linux1.softberry.com/ berry.phtml
Journal of Investigative Dermatology
2006 126, 325–335. doi:10.1038/sj.jid.5700065
Transcriptional Regulation and Characterization of the Promoter Region of the Human ABCC6 Gene
Qiujie Jiang1, Yasushi Matsuzaki1, Kehua Li and Jouni Uitto
# Department of Dermatology and Cutaneous Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania, USA
# 2Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania, USA
... putative cis-acting elements using transcription factor databases (TFSEARCH, Kyoto
University, version 1.3) and ConSite (nsiteM, Softberry, Inc., version 2.2004 ...
Plant Molecular Biology
Volume 58, Number 2 / May 2005 pp. 193-212
Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana
Rachel Clifton et al.,
Plant Molecular Biology Group, School of Biomedical and Chemical Sciences,, The University of Western Australia, 35 Stirling Highway, 6009 Crawley, Western Australia, Australia
... jsp). Pre- viously described motifs were identified using Softberry nsiteM (Shahmuradov
et al., 2003), PlantCARE (Lescot et al., 2002), PLACE (Higo et al., 1999 ...
PloS one
2014, 9(1), e84692. DOI: 10.1371/journal.pone.0084692
Isolation and Characterization of Three Cassava Elongation Factor 1 Alpha (MeEF1A) Promoters
Suhandono, S., Apriyanto, A., Ihsani, N.
School of Life Sciences and Technology, Institut Teknologi Bandung, Bandung, Jawa Barat, Indonesia
... www.cbs.dtu.dk/services/NetGene2/) [51]. Conserved cis-acting regulatory was
carried out using the PATTERN search from Softberry website (http://www.softberry.
com/berry.phtml). PLACE [52] and PlantCARE [53] software ...
Nature and Science,
4(3), 2006
An In Silico Investigation into the Discovery of
Novel Cis-acting Elements within the Intronic Regions of Human PAX7
Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan
University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center),
New York City, New York 10021, USA
The names and functions of the programs used are:
...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) -
This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) -
TSSG is the most accurate mammalian cis element prediction program.
JAPS, Journal of Animal and Plant Sciences
2015, 25(1), 254-260.
Codon optimization of Serratia marcescens chiA and its expression in tobacco.
Pasha, M. A., Belgaumwala, A., Kumar, R., Krishnaraj, P. U., Kuruvinashetti, M. S.
Department of Biotechnology, University of Agricultural Sciences, Dharwad-580005, Karnataka, India
... degenerate codons manually. PolyAH and splice sites were predicted with the help
of online tool Softberry (www.softberry.com), which predicts the potential splice
sites present in the genomic DNA. The designed sequence ...
Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6
DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic
Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland
2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA
... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures
in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry),
3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...
Gene
Volume 529, Issue 2, 25 October 2013, Pages 228–237 DOI:10.1016/j.gene.2013.07.103
Splicing variants of the porcine betaine–homocysteine S-methyltransferase gene: Implications for mammalian metabolism
Radhika Ganu a, Timothy Garrow b, Markos Koutmos c, Laurie Rund d, Lawrence B. Schook a, d,
a Division of Nutritional Sciences, University of Illinois, Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois, Urbana, IL 61801, USA
... The mRNA secondary structures and free energy values were predicted using the MFOLD software
program (version 3.2; http://www.bioinfo.rpi.edu/applications/mfold)(Zuker, 2003). PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect poly A signal sites. ...
Journal of Investigative Dermatology
(6 December 2012) | doi:10.1038/jid.2012.458
A Genome-Wide Association Study in Caucasian Women Points Out a Putative Role of the STXBP5L Gene in Facial Photoaging
Clerc et al.,
... exploration we tried to look for modifications in mRNA expression levels (Yang et al., 2010; Nica
et al., 2011; Dixon et al., 2007; Zeller et al., 2010), splicing (NetGene2, http://www.cbs.dtu.dk/
services/NetGene2/), polyadenylation regions (polyAH, http://linux1.softberry.com/berry ...
PLoS ONE
7(5): e36151. doi:10.1371/journal.pone.0036151
3D Profile-Based Approach to Proteome-Wide Discovery of Novel Human Chemokines
Tomczak et al.,
Structural Bioinformatics, BIOTEC TU Dresden, Germany
Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany
... Exon organization, chromosomal location and proximity to known chemokine genes,
presence of a PolyA site (using Ensembl, Polyah.pl (softberry) and Polyadq ...
Biologia Plantarum
December 2012, Volume 56, Issue 4, pp 641-647 DOI
10.1007/s10535-012-0255-3
Identification and characterization of a novel gene encoding myb-box binding zinc finger protein in Gossypium arboreum
M. Zahur et al.,
1. Department of Biochemistry and Molecular Biology, University of Gujrat, Gujrat, 50700, Pakistan
... 1990). To find out the untranslated regions (UTRs), and Poly-A tail softberry server was used
(http://www.softberry.com/berry.phtml). The conceptual translation of nucleotide sequence
was made using the open reading frame finder program (ORF; ...
Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015
Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes
Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/
proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...
Gene
Volume 483, Issues 1–2, 1 September 2011, Pages 49–53 DOI: 10.1016/j.gene.2011.05.014
Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid
Pardeep Kumar Bhardwaj a, b, 1, Jagdeep Kaur b, Ranbir Chander Sobti b, Paramvir Singh Ahuja a, Sanjay Kumar a
a Biotechnology Division, Institute of Himalayan Bioresource Technology, Council of Scientific and Industrial Research, P.O. Box 6, Palampur-176061, Himachal Pradesh, India
b Department of Biotechnology, Panjab University, Chandigarh-160014, India
... Secondary structure of deduced amino acids sequences was predicted by SOPMA (Self Optimized
Prediction Method with Alignment; http://npsa-pbil.ibcp.fr/). The polyadenylation signal was
identified using POLYAH server (http://linux1.softberry.com/berry.phtml). ...
J Acquir Immune Defic Syndr.
2011 March; 56(3): 279–284. DOI: 10.1097/QAI.0b013e318204982b
SCREENING LOW FREQUENCY SNPS FROM GENOME WIDE ASSOCIATION STUDY REVEALS A NEW RISK ALLELE FOR PROGRESSION TO AIDS
Le Clerc et al.,
1 Chaire de Bioinformatique, Conservatoire National des Arts et Metiers, Paris, France
2 Universite Paris 12, INSERM U955, Creteil, France
... we tried to identify putative modifications in mRNA expression as shown in Genevar 26 and Dixon
27 databases, in splicing (FastSNP 28 , http://fastsnp.ibms.sinica.edu.tw/pages/
input_CandidateGeneSearch.jsp/), in polyadenylation (polyAH, http://linux1.softberry.com/berry ...
African Journal of Biotechnology
Vol. 8 (24), pp. 7116-7124, 15 December, 2009
Cloning and characterization of peptidylprolyl
isomerase B in the silkworm, Bombyx mori
Hengchuan Xia et al.,
1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China
... Corporation. Bioinformatic analysis The DNAstar software was used to locate the open
reading frame (ORF) for B. mori PPIB. Poly-A signal was predicted by POLYAH
(http://www.softberry.com/cgi-bin/programs/promoter/polyah.pl). In ...
Genetics
Vol. 176, 2541-2549, August 2007
The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus
Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences,
South China Agricultural University, Guangzhou, 510642, China and
Key Biotechnology Laboratory of State Ethnic Affairs Commission,
College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China
... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH,
respectively (http://www.softberry.com/berry.html). ...
PLoS ONE
5(9): e12599. doi:10.1371/journal.pone.0012599
The CC-NB-LRR-Type Rdg2a Resistance Gene Confers Immunity to the Seed-Borne Barley Leaf Stripe Pathogen in the Absence of Hypersensitive Cell Death
Bulgarelli et al.,
1 Genomic Research Center, CRA-GPG, Fiorenzuola d'Arda, Italy, 2 Department of Plant Microbe Interactions, Max Planck Institute fur Zuchtungsforschung, Koln, Germany
... The PromH program for the prediction of plant promoters (http://www.softberry.ru/berry.phtml?
group=programs&subgroup=promoter&topic=tssp , [47]) identified potential transcription factor
binding sites, a TATA box, and a likely promoter within the MITE sequence (data not ...
Nucleic Acids Research,
2003, Vol. 31, No. 13 3540-3545
PromH: promoters identification using orthologous genomic sequences
V. V. Solovyev* and I. A. Shahmuradov1
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com
Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Received February 15, 2003; Revised and Accepted March 21, 2003
Nucleic Acids Res
(2017) 45 (D1): D1075-D1081. DOI:https://doi.org/10.1093/nar/gkw1135
Rice SNP-seek database update: new SNPs, indels, and queries
Locedie Mansueto et al.,
International Rice Research Institute, College, Los Banos, Laguna 4031, Philippines; Arizona Genomics Institute, School of Plant Sciences, University of Arizona, Tucson, AZ 85750, USA
...First, we merged the Nipponbare MSUv7 (16) and RAP (17) gene models, plus in-house
FGenesh++ (18) annotation into a single set of gene models and named them using our convention, of the form OsNippo{YY}g{NNNNNN}...
...The annotations can include gene models (RAP (17), MSUv7 (16) or FGenesh++ (18)) or promoter regions
(FGenesh++, PlantPromDB (24)) if SNPs are located within these loci....
Journal of Integrative Agriculture
2017, 16(0): 60345-7 doi: 10.1016/S2095-3119(16)61548-4
Identification and functional characterization of the MdHB-1 gene promoter sequence from Malus? domestica
WANG HJ et al.,
1 College of Horticulture, Northwest A&F University, Yangling 712100, P.R.China
2 Institute of Economic Crop Research, Shiyan Academy of Agricultural Sciences, Shiyan 442714, P.R.China
... The transcriptional start site (TSS) of the MdHB-1 promoter was ascertained in the PlantProm DataBase (http://wwwsoftberry.com/)(Shahmuradov et al. 2003; Liu et al. 2011). 2.4. ... The Softberry database
re- vealed that the TSS, CAAT-box, and TATA-box are located in –266, –307, and
–299 nt upstream of the initiation code (ATG), respectively (Fig. ...
Plant Biotechnology Reports
2016, 10(4), 241-255. doi:10.1007/s11816-016-0400-0
Functional analysis of a cryptic promoter from Arabidopsis thaliana reveals bidirectionality
Parvathy, S. T., Srinivasan, R.
ICAR-National Research Centre on Plant BiotechnologyIndian Agricultural Research Institute
ICAR-Indian Institute of Oilseeds Research
... 2000; http://www.genomatix.de/), Gene2 Promoter (http://www.genomatix.de/), McPromoter (Ohler
et al. 2001; http://tools.genome.duke.edu/generegulation/McPromoter/) and PlantProm DB of
SoftBerry Inc. (Shahmuradov et al. 2002; http://www.softberry.com/). ...
Turkish Journal of Botany
2015, 39(4), 571-579. doi:10.3906/bot-1405-70
Differential expression of soluble pyrophosphatase isoforms in Arabidopsis upon external stimuli
Oeztuerk, Z. N., Greiner, S., & Rausch, T.
1Centre for Organismal Studies (COS), Plant Molecular Physiology, Ruprecht-Karls-Universitat Heidelberg, Heidelberg, Germany 2Department of Agricultural Genetic Engineering, Faculty of Agricultural Sciences and Technologies (FAST), Nigde University, Nigde, Turkey
... Resource) were analyzed for the presence of known cis-acting elements related to the response
to changes in environmental conditions using the plant web- based programs PLACE (Higo et
al., 1999) and TFSearch (Heinmeyer et al., 1998), and Softberry PlantProm database ...
Journal of Biotechnology
174 (2014) 49–56 DOI: 10.1016/j.jbiotec.2014.01.027
Strong seed-specific protein expression from the Vigna radiata storage protein 8SG promoter in transgenic Arabidopsis seeds
Chen M. X. et al.,
aCollege of Life Science and Technology, Jinan University, Guangzhou 510632, ChinabSchool of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, Chinaa
... HQ214071, Chen et al., 2013) and the 661-bp 5 -flanking sequence of 8SG? (GenBank accession
No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.com) was
uti- lized to predict the transcription start site (TSS) and the TATA box. ...
Journal of biotechnology
2014, 174, 49-56. DOI: 10.1016/j.jbiotec.2014.01.027
Strong seed-specific protein expression from the Vigna radiata storage protein 8SG? promoter in transgenic Arabidopsis seeds.
Chen M. X. et al.,
a College of Life Science and Technology, Jinan University, Guangzhou 510632, China
b School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China
... HQ214071, Chen et al., 2013) and the 661-bp 5?-flanking sequence of 8SG? (GenBank
accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.
com) was utilized to predict the transcription start site (TSS) and the TATA box. ...
Functional & integrative genomics
2014, 14(1), 111-125. DOI: 10.1007/s10142-013-0354-z
The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance
Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China
2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China
... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region
of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1.
softberry.com/berry.phtml). Promoter motifs were analyzed ...
Plant Molecular Biology Reporter
2014, 32(3), 664-678. DOI: 10.1007/s11105-013-0681-1
Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses
Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China
2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China
... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream
region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD)
(http://linux1.softberry.com/ berry.phtml). The promoter ...
Plant Molecular Biology Reporter
2014, 32(1), 198-208. DOI: 10.1007/s11105-013-0641-9
Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa
Rodriguez-Valentin R. et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico
2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico
... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried
by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/
berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...
Journal of Molecular Biology Research
Vol 3, No 1 (2013) DOI:10.5539/jmbr.v3n1p23
Characterization of Structure, Divergence and Regulation Patterns of Plant Promoters
Liu et al.,
... less often than transcribed gene sequences. A total of 3922 plant promoters in the
Plant Promoter Database (PlantProm DB; http://linux1.softberry.com/berry.phtml)
have been collected to date. Knowledge of the basic structural ...
Functional & Integrative Genomics
December 2013 DOI:10.1007/s10142-013-0354-z
The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance
Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China
2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China
... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region
of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1.
softberry.com/berry.phtml). Promoter motifs were analyzed ...
Plant Molecular Biology Reporter
November 2013 DOI:10.1007/s11105-013-0681-1
Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses
Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China
2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China
... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream
region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD)
(http://linux1.softberry.com/ berry.phtml). The promoter ...
Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 198-208 DOI:10.1007/s11105-013-0641-9
Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa
Rodriguez-Valentin, et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico
2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico
... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried
by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/
berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...
Australian Journal of Grape and Wine Research
19: 238–248. doi: 10.1111/ajgw.12023
Anthocyanin profile and gene expression in berry skin of two red Vitis vinifera grape cultivars that are sunlight dependent versus sunlight independent.
Zheng et al.,
1Beijing Key Laboratory of Grape Sciences and Enology, CAS Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China
2University of Chinese Academy of Sciences, Beijing, China
3Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China
... figure. There was no difference in the isolated promoter regions of VvMYBAb1 between Jingxiu
and Jingyan (Figure 5). Via a homology search of the isolated promoter regions using the
PlantProm (Plant Promoters database http://linux1.softberry.com/berry.phtml) and PlantDB ...
J. Exp. Bot.
(2012) 63 (8): 2985-3000. doi: 10.1093/jxb/ers009
The gene encoding Arabidopsis acyl-CoA-binding protein 3 is pathogen inducible and subject to circadian regulation
Shu-Xiao Zheng,
Shi Xiao* and
Mee-Len Chye†
School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China
... Results using SoftBerry PlantProm DB (http://www.softberry.com) (Shahmuradov et al., 2003)
and PlantCare (http://sphinx.rug.ac.be:8080/PlantCARE/) (Rombauts et al., 1999) revealed that
the putative transcription start site of ACBP3 maps 93 bp 5? to the translation initiation ...
Algorithms for Molecular Biology
2011, 6:19 http://www.almob.org/content/6/1/19
Prediction of plant promoters based on hexamers and random triplet pair analysis
A K M Azad1 , Saima Shahid2 , Nasimul Noman 3* and Hyunju Lee 1
1 Department of Information and Communications, Gwangju Institute of
Science and Technology, South Korea
3 Department of Electrical Engineering & Info Systems, Graduate School of
Engineering, University of Tokyo, Japan
... validated TSSs. This dataset was downloaded from the recent release (2009.02) of
PlantProm database http://linux1.softberry.com/berry. phtml?topic=plantprom&group=
data&subgroup=plant- prom on January 2nd, 2011. Additional ...
Genetics and Molecular Research
9 (4): 2349-2356 (2010)
Molecular and functional analysis of the poly-b-
hydroxybutyrate biosynthesis operon of Pseudomonas sp BJ-1
S.W. Zhu, Z.Y. Fang, H.Y. Jiang and B.J. Cheng
School of Life Science, Anhui Agricultural University, Hefei, China
... Predicted operons, promoters, and terminators were identified with the tools at Softberry
(http://www.softberry. com/berry.phtml). ... SW Zhu et al. Promoter analysis The promoter prediction
used the promoter database and the Softberry Plant Regula- tory motifs database. ...
Plant Physiology and Biochemistry
Volume 48, Issue 12, December 2010, Pages 945-951, doi:10.1016/j.plaphy.2010.09.005
Characterization and expression of the maize b-carbonic anhydrase gene repeat regions
Ursula Tems, James N. Burnell
Department of Biochemistry and Molecular Biology, James Cook University, Townsville, Queensland 4811, Australia
... gov). Nucleotide sequence up to 1,500 bp in the 5 flanking sequence of the CA2
gene was analyzed using a transcription factor database (PlantProm DB at
www.softberry.com) in conjunction with MacVectorTM software. 4.3. ...
BMC Plant Biol.
2009 Jul 17;9:93.
Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.
Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.
... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter
recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih.
gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...
Journal of Cereal Science
Volume 50, Issue 3, November 2009, Pages 324-331
Isolation and characterisation of a xylanase inhibitor Xip-II gene from durum wheat
Elliott et al.,
aInstitute of Food Research (IFR), Norwich Research Park, Colney, Norwich NR4 7UA, UK
bUniversita degli Studi della Tuscia, Dipartimento di Agrobiologia e Agrochimica, via San Camillo de Lallis, 01100 Viterbo, Italy
... Analysis of the 3'UTR by PlantProm DB (Shahmuradov et al., 2003) (http://www.softberry.
com) revealed the presence of a single putative polyadenylation sequence (AATAAAA),
starting 55 bp downstream of the TGA termination codon (Fig. S1). ...
Nucleic Acids Research
2006 34(19):e126; doi:10.1093/nar/gkl522
Robust analysis of 5'-transcript ends (5'-RATE): a novel technique for transcriptome analysis and genome annotation
Malali Gowda, Haumeng Li, Joe Alessi1, Feng Chen1, Richard Pratt2 and Guo-Liang Wang*
Department of Plant Pathology, The Ohio State University Columbus, OH 43210, USA 1 US DOE Joint Genome Institute, Walnut Creek CA 94598, USA 2 Department of Horticulture and Crop Science, Ohio Agricultural Research and Development Center, The Ohio State University Wooster, OH 44691, USA
... such as the TATA box and other cis-acting elements were predicted using a PlantProm
DB program (http://mendel.cs.rhul.ac.uk and http://www.softberry.com) (20). ...
Genetics:
Published Articles Ahead of Print,
published on September 19, 2005 as 10.1534/genetics.105.044727
Molecular characterization of the major wheat domestication gene Q
Kristin J. Simons*, John P. Fellers‡, Harold N. Trick*, Zengcui Zhang§, Yin-Shan Tai, Bikram
S. Gill*, and Justin D. Faris
*Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University,
Manhattan, KS 66506
... searches of plant promoter databases PlantCARE (http://intra.psb.ugent.be:8080/
PlantCARE/index.html), PlantProm (http://www.softberry.com), ...
Annals of Botany
2005 96(4):669-681; doi:10.1093/aob/mci219
Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species
BIJAYALAXMI MOHANTY1,*, S. P. T. KRISHNAN1, SANJAY SWARUP2 and VLADIMIR B. BAJIC1
1 Knowledge Extraction Laboratory, Institute for Infocomm Research, 21 Heng Mui Keng Terrace, Singapore 119613 and 2 Department of Biological Sciences, National University of Singapore, Singapore
... Promoter sequences Plant promoter sequences were extracted from
SoftBerry's Plant Promoter Database (PPD) (Shahmuradov et al., 2003 Go ), the Eukaryotic ...
Surgery Today
Volume 34, Number 12 / December, 2004 pp. 981-986
Role of Hypermethylation on Carcinogenesis in the Pancreas
Tamotsu Kuroki 1 Yoshitsugu Tajima 1 and Takashi Kanematsu 1
(1) Department of Surgery, Nagasaki University, Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki 852-8501, Japan
... of Bioinformatics and http://www.isrec.isb-sib.ch/ssa Swiss Institute for Experimental
Cancer Research, Eukaryotic Promoter Database Softberry, Promoter and ...
Nucleic Acids Research
2003, Vol. 31, No. 1 114-117
PlantProm: a database of plant promoter sequences
Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA
... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based
on discriminant analysis has been created by Softberry Inc. ...
Plant Molecular Biology Reporter
2014, 32(2), 372-381. DOI: 10.1007/s11105-013-0657-1
Initiation of Flowering in Protea compacta x Protea neriifolia Hybrid ‘Carnival’Coincides with Expression of the FLOWERING LOCUS THomologue
Smart M., Roden L. C.
1. Department of Molecular and Cell Biology, University of Cape Town, Private Bag, Rondebosch, 7701, Cape Town, South Africa
2. Institute for Microbial Biotechnology and Metagenomics, Department of Biotechnology, University of the Western Cape, Bellville, 7535, Cape Town, South Africa
... In silico analyses of the 5? upstream region of ProFT were performed using the RegSite Plant
database (SoftBerry, Inc., NY, USA), to predict the transcrip- tion start site (TSS) and promoter
position, and the PlantCARE database (Lescot et al. 2002) and PLACEDB (Higo et al. ...
Plant Molecular Biology Reporter
Volume 30, Issue 1 , pp 131-138 DOI
10.1007/s11105-011-0319-0
Isolation and Partial Characterization of an R2R3MYB Transcription Factor from the Bamboo Species Fargesia fungosa
Juan Wang (1)
Jing Wang (1)
Huaibi Zhang (2)
Yuming Yang (1)
Kevin M. Davies (2)
1. Southwest Forestry University, Bailongsi 300, Kunming, Yunnan, China
2. New Zealand Institute for Plant & Food Research Limited, Private Bag, 11600, Palmerston North, New Zealand
... PLANTCARE (Lescot et al. 2002, with additional data from El-Shehawi et al. 2011)
and RegSite Plant DB (www. softberry.com) databases. The proximal 1 kb region
contained several notable sequence motifs (Fig. 2 and Table 1 ...
Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x
Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)
Xia YANG 1,
Hong CUI 2,
Zu-Li YUAN 2,
Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China
2 Henan Agricultural University, Zhengzhou 450002, China
... To predict the promoter regions and the transcription start sites, genomic regions upstream of
the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region
and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ...
SCIENCE CHINA Life Sciences
Volume 53, Number 11, 1315-1321, DOI: 10.1007/s11427-010-4079-0
Expression pattern and core region analysis of AtMPK3 promoter in response to environmental stresses
Fei Gao, Qi Su, YunLiu Fan and Lei Wang
... There are several plant-specific promoter databases with information on cis-acting elements,
which control the initia- tion of transcription by binding corresponding nuclear fac- tors. These
databases include PlantCARE [23], RegSite (http://softberry. ...
Methods Mol Biol.
2010;674:57-83
Identification of promoter regions and regulatory sites
Solovyev VV, Shahmuradov IA, Salamov AA.
Department of Computer Science, Royal Holloway, London, UK.
... Over 7,900 sequences of transcrip- tional elements have been described in
TRANSFAC database (21, 22). The other collections of functional motifs are TRRD
(23), PlantCARE (24), PLACE (25), RegSite (http://softberry. com ...
Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821
Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines
Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
... was based on program of ScanWM-PL and accession numbers of regula- tion factors
were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...
Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia
... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters
(using the RegSite plant database, Softberry, http://www.softberry.com). ...
Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007
Molecular and cytological responses of Medicago truncatula
to Erysiphe pisi
DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA
... groups of promoters using (1) > 20 published motifs associated with plant defence,
(2) 803 regulatory motifs present in the Softberry RegSite PlantDB database ...
Cell Res.
2006 Aug;16(8):731-9.
Tissue differential expression of lycopene beta-cyclase gene in papaya.
Skelton RL, Yu Q, Srinivasan R, Manshardt R, Moore PH, Ming R.
1Hawaii Agriculture Research Center, Aiea, HI 96701, USA.
... upstream sequence. Two possible sites of the cpLCY-B promoter were predicted
using RegSite Plant DB (www.softberry.com). The first ...
PLOS ONE
July 30, 2013DOI: 10.1371/journal.pone.0069124
The LuWD40-1 Gene Encoding WD Repeat Protein Regulates Growth and Pollen Viability in Flax (Linum Usitatissimum L.)
Santosh Kumar, Mark C. Jordan, Raju Datla, Sylvie Cloutier
Department of Plant Science, University of Manitoba, Winnipeg, Manitoba, Canada, Cereal Research Centre, Agriculture and Agri-Food Canada, Winnipeg, Manitoba, Canada
... Promoter analysis was performed with PLAnt Cis-acting regulatory DNA Elements (PLACE) [42],
PLANT Promoter Analysis Navigator (PlantPAN) and Weight Matrix patterns of PLant regulatory
sequences (ScanWM-PL) available on the Softberry web portal (http://linux1.softberry ...
Journal of Integrative Plant Biology
Volume 54, Issue 1, pages 15–32, January 2012 DOI: 10.1111/j.1744-7909.2011.01084.x
Characterization of the Tomato Prosystemin Promoter: Organ-specific Expression, Hormone Specificity and Methyl Jasmonate Responsiveness by Deletion Analysis in Transgenic Tobacco Plants
Hamlet Aviles-Arnaut, John Paul Delano-Frier
Center of Research and Advanced Studies (Cinvestav) at Irapuato: Unit for Plant Biotechnology and Genetic Engineering, Irapuato, Gto., Mexico, PO Box 36821 Mexico
... (www.dna.affrc.go.jp/PLACE/), PlantCARE (http://bioinformatics.SlPSb.ugent.be/wetools/
plantcare/html/), the RegSite Plant Database (www.softberry.com) and the Genomatix ... compared
against known cis-regulatory elements with the ScanWM-P software (www.softberry.com). ...
Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24
Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar
Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.
... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb.
ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry,
http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ...
Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394
Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar
Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China
... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as
UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to
predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...
Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821
Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines
Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
... was based on program of ScanWM-PL and accession numbers of regula- tion factors
were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
Nucleic Acids Research
2017 Jan 12:gkw1353. DOI: https://doi.org/10.1093/nar/gkw1353
TSSPlant: a new tool for prediction of plant Pol II promoters
Shahmuradov IA, Umarov RK, Solovyev VV.
King Abdullah University of Science and Technology, Thuwal 23955-6900, Saudi Arabia;
Institue of Molecular Biology and Biotechnologies, ANAS, 2 Matbuat strasse, Baku AZ1073, Azerbaijan
... of PromoBot and other promoter predictors (NNPP 2.2, Promoter 2.0, TSSP-TCM, Promoter Scan
1.7, and PromMachine) on short (251 bp) promoter and non-promoter sequences showed that
NNPP 2.2, TSSP-TCM, PromMachine and TSSP (http://www.softberry.com/berry.phtml ...
Gene
Volume 609, 20 April 2017, Pages 1–8 http://dx.doi.org/10.1016/j.gene.2017.01.029
The fate of retrotransposed processed genes in Arabidopsis thaliana
Abdelkarim BT, Maranda V, Drouin G.
Departement de biologie et Centre de recherche avancee en genomique environnementale, Universite d'Ottawa, Ottawa, Ontario K1N 6N5, Canada
... TATA-Box sequences were identified using the Softberry TSSP Prediction of PLANT
Promoters tool (http://www.softberry.com/berry.phtml?topic=tssp&group=
programs&subgroup=promoter). 3. Results. 3.1. Processed genes. ...
BMC Plant Biology
2017 Feb 1;17(1):32. DOI: 10.1186/s12870-017-0983-9
Conservation and diversification of the miR166 family in soybean and potential roles of newly identified miR166s
Li X et al.,
College of Plant Science, Jilin University; Agriculture and Agri-Food Canada, London Research and Development Centre; Department of Biology, Western University
...The transcription start sites of MIR166 genes were predicted by TSSP software in Softberry (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter). ...
New Phytologist
6 September 2016 DOI: 10.1111/nph.14163
How petals change their spots: cis?regulatory re?wiring in Clarkia (Onagraceae)
Martins, T.R., Jiang, P. and Rausher, M.D.
Department of Biology, Duke University, Durham, NC, USA
Department of Agriculture, Nutrition and Veterinary Sciences, University of Nevada, Reno, NV, USA
... The transcription start site and promoter region were predicted using the Softberry TSSP software
(http://www.softberry.com/), and the promoter cis-acting regulatory elements were analyzed based
on the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare ...
Tree Genetics & Genomes
2016, 12(6), p.106. doi:10.1007/s11295-016-1066-z
Molecular characterization, critical amino acid identification, and promoter analysis of a lycopene b-cyclase gene from citrus
Lu, S. et al.,
Key Laboratory of Horticultural Plant Biology, Ministry of EducationHuazhong Agricultural UniversityWuhanChina
... amplification. The full-length promoters were obtained by sequence assembly.
Promoter regions and plant regulatory motifs were searched using the SoftBerry TSSP
and Nsite-PL program (http://linux1.softberry.com/). A search ...
Organ Cult
(2016) 126: 469. doi:10.1007/s11240-016-1015-4
Characterization of a trichome-specific promoter of the aldehyde dehydrogenase 1 (ALDH1) gene in Artemisia annua
Liu, M. et al.,
Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D CenterShanghai Jiao Tong University
Department of Chemistry and Biomedical SciencesLinnaeus University
... The cis-acting elements and ATG start codon are in box. We used the TSSP software
(http://?linux1.?softberry.?com/?berry.?phtml??topic=?tssp&?group=?programs&?
subgroup=?promoter) to search more information about this promoter. ...
Biotechnology and Applied Biochemistry.
2016 DOI: 10.1002/bab.1520
Molecular cloning and characterization of the promoter of aldehyde dehydrogenase gene from Artemisia annua
Wang, H. et al.,
Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing, China
School of Chemistry and Chemical Engineering, Chongqing University of Science and Technology, Chongqing, China
... element of the ALDH1 promoter was analyzed by the TSSP software (http:// http://linux1.softberry.
com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) [24], the PlantCARE software
(http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and the PLACE ...
Genes & Genomics
2016, 38(4), 377-387. DOI: 10.1007/s13258-015-0378-y
Genomic identification of microRNA promoters and their cis-acting elements in Populus
Chen, M., Wei, M., Dong, Z., Bao, H., Wang, Y.
1. National Engineering Laboratory for Tree Breeding, Beijing Forestry University, Beijing, 100083, People’s Republic of China
2. Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, People’s Republic of China
... Prediction and characterization of TSSs, TATA box- like sequences With the obtained
sequences, TSSs and TATA box-like sequences were predicted using the plant promoter
identifi- cation program, TSSP (http://linux1.softberry.com/berry. ...
Plant Physiology
2016 Vol. 162, No. 2 (June 2013), pp. 885-896 http://www.jstor.org/stable/41943270
The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear
Wang Z. et al.,
... name proPcMYBlO (JX403962). It contained a core promoter at position -60 bp and
an enhancer promoter at position -675 bp (as analyzed by TSSP software on softberry;
http:/ /linuxl. softberry.com/berry.phtml). Be- sides the ...
Molecular Genetics and Genomics
2016, Volume 291, Issue 2 , pp 935-941 DOI 10.1007/s00438-015-1159-7
Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes
Ranade, S. S., Garcia-Gil, M. R., Rossello, J. A.
1. Department of Forest Genetics and Plant Physiology, Umea Plant Science Centre, Swedish University of Agricultural Sciences, 901 83, Umea, Sweden
2. Jardi Botanic, Universidad de Valencia, c/Quart 80, 46008, Valencia, Spain
... Upstream regions were also screened for the pres- ence of promoters, TATA boxes and enhancers
using the TSSP/Prediction of Plant Promoters (TSSP: Transcription Start Sites in Plants, SoftBerry:
http://www.softberry.com, Shahmuradov et al. 2003) web interface. Results ...
Genetics and Molecular Research
2015, 14(4), 16756-16770. DOI http://dx.doi.org/10.4238/2015.December.14.3
Isolation and characterization of Calcineurin B-like gene (PbCBL1) and its promoter in birch-leaf pear (Pyrus betulifolia Bunge)
Xu, Y. Y. et al.,
Key Laboratory for Horticultural Crop Genetic Improvement, Institute of Horticulture, Jiangsu Academy of Agricultural Sciences, Nanjing, China
... TA cloning. The promoter's transcription start sites (TSS) were predicted using the
Softberry databases (http://linux1.softberry.com/berry.phtml?topic=tssp&group=
program& subgroup=promoter) (Liu et al., 2011). The TFSearch ...
Applied biochemistry and biotechnology
2015, Volume 176, Issue 3 , pp 835-849 DOI: 10.1007/s12010-015-1614-2
Identification and Characterization of High Temperature Stress Responsive Novel miRNAs in French Bean (Phaseolus vulgaris)
Jyothi, M. N., Rai, D. V.
1. Post Graduate Department of Biochemistry, Maharani’s Science College for Women, Palace Road, Bangalore, 560001, India
2. Centre for Bioinformatics, Faculty of Biological Engineering, Shobhit University, Meerut, India
... Upstream sequences of 1 kb were retrieved at the beginning of the pre-miRNA for the prediction
of transcription start site (TSS) for all the types of miRNA (genic and intergenic). The TSS and
TATA-box predictions were made using TSSP web tool (http://linux1.softberry.com) [29]. ...
Gene
Volume 574, Issue 2, 15 December 2015, Pages 210–216 doi:10.1016/j.gene.2015.08.007
Identification of microRNAs and their targets in Finger millet by high throughput sequencing
S. Usha et al.,
a Post Graduate Department of Biochemistry, Maharani's Science College for Women, Bangalore 560001, India
b Department of Biochemistry, Indian Institute of Science, Bangalore 560012 India
... The miRNAs were assumed as independent transcription units to have uniformity. The
TSS and TATA-box predictions were made using TSSP web tool (http://linux1.softberry.
com/berry.phtml?topic=tssp&group=programs&subgroup=promoter). ...
Molecular Genetics and Genomics
2015, 290(5), 1819-1831 DOI: 10.1007/s00438-015-1043-5
Identification and characterization of paternal-preferentially expressed gene NF-YC8 in maize endosperm
Mei, X. et al.,
1. Maize Research Institute, Key Laboratory of Biotechnology and Crop Quality Improvement, Ministry of Agriculture, Southwest University, Chongqing, China
... The promoter region of NF-YC8 was predicted by softberry (http://?linux1.?softberry.?com/?
berry.?phtml??topic=?tssp&?group=?programs&?subgroup=?promoter), and CpG islands
were predicted by the EMBOSS Cpgplot program (http://?www.?ebi.?ac.?uk/?Tools ...
Journal of Zhejiang University SCIENCE B
2014, 15(2), 125-132. DOI:10.1631/jzus.B1300179
Analysis of promoters of microRNAs from a Glycine max degradome library
Han, Y. Q. et al.,
1. College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, 163319, China
2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... Promoters were predicted by the plant promoter identification pro- gram TSSP
(http://www.softberry.com), which is designed for predicting plant Pol II promoters
(Shahmuradov et al., 2005). The predictions were obtained at the default TSSP settings. ...
Biochemical and biophysical research communications
2014, 444(4), 676-681. DOI: 10.1016/j.bbrc.2014.01.171
MicroRNA mediates DNA methylation of target genes
Hu, W., Wang, T., Xu, J., Li, H.
a College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, China
b Zhejiang-California International Nanosystems Institute, Zhejiang University, Hangzhou, Zhejiang 310058, China
... 0). 2.2. DNA methylation pattern of MIRs. 1 or 2 kb upstream and downstream
sequences of pre-miRNA were retrieved from rice genome. Promoters of MIRs were
predicted by TSSP (http://linux1.softberry.com/berry.phtml). Then ...
Euphytica
2014, 196(3), 365-374. DOI: 10.1007/s10681-013-1038-4
Variation in GmAOS1 promoter is associated with soybean defense against insect attack
Wang H. et al.,
1. Soybean Research Institute, Nanjing Agricultural University, National Center for Soybean Improvement, Ministry of Agriculture, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing, 210095, Jiangsu, China
... 1997 ). SoftBerry-TSSP (http://?linux1.?softberry.?com/?berry.?phtml) was used to predict
the position of promoter (Shahmuradov et al. 2003 ) and PlantCARE was used to predict
the cis-regulating elements for GmAOS1 (Lescot et al. 2002 ). ...
Biologia Plantarum
2014, 58(2), 247-255. DOI: 10.1007/s10535-014-0393-x
Structural and expression analyses of three PmCBFs from Prunus mume
Guo C. et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, 430070, P.R. China
... The promoter region of PmCBFb was identified by the prediction of plant promoters (TSSP)
analysis in softberry database (http:// linux1.softberry. com/berry.phtml). The cis-element
analysis was performed by signal scan searching in the PLACE ...
Plant Molecular Biology Reporter
2014, 32(1), 82-91. DOI: 10.1007/s11105-013-0603-2
Jiang, W., Lu, X., Qiu, B., Zhang, F., Shen, Q., Lv, Z., ... & Tang, K. (2014). Molecular cloning and characterization of a trichome-specific promoter of artemisinic aldehyde ?11 (13) reductase (DBR2) in Artemisia annua.
Jiang W. et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were
analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE
software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...
Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020
Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles
da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil
2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil
...On the other hand, the same TA repeat block displays a predicted potential to function as a
TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ...
...Finally, there is at least one predicted pre-miRNA
(Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...
Gene
2014, 545(1), 45-55. Volume DOI: 10.1016/j.gene.2014.05.008
Characterization of the promoter and 5?-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus
Xiao G. et al.,
a Key Laboratory of Oil Crop Biology of Ministry of Agriculture, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, Hubei 430062, China
b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, PR China
... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml)
and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.
html) web servers; the known cis-acting elements were analyzed through a web ...
Scientia Horticulturae
2014, 175, 16-26. DOI: 10.1016/j.scienta.2014.05.032
Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3? H1 sequences between Tulipa fosteriana‘Albert heijn’and its reddish sport
Yuan, Y., Ma, X., Tang, D., Shi, Y.
School of Agriculture & Biology, Shanghai Jiao Tong University, Shanghai 200240, China
... The putative transcriptional start site (TSS) and cis-elements in the 5?flanking region of
TfF3?H1AH were predicted by the Softberry database (http://linux1.softberry.com/berry.phtml?
topic=tsssp&group=programs&subgroup=promoter) and the PLACE database (http://www.dna ...
Planta
Volume 237, Issue 4 , pp 1149-1161 DOI:10.1007/s00425-012-1833-5
Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum)
Vitthal T. Barvkar et al.,
1. Biochemical Sciences Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Plant Biotechnology Institute, NRC, 110 Gymnasium Place, Saskatoon, SK, S7N 0W9, Canada
... This sequence was used for prediction of transcription start sites (TSS) using the TSSP
(http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter)
program from the softberry package (Solovyev and Salamov 1997 ). ...
Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6
DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic
Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland
2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA
... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures
in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry),
3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...
Tree Genetics & Genomes
October 2013, Volume 9, Issue 5, pp 1369-1381 DOI:10.1007/s11295-013-0640-x
Nucleotide sequence analysis of two lignin genes in Acacia auriculiformis ? Acacia mangium hybrid for enhancement of wood pulp quality
A. Sukganah, C. Y. Choong, J. Russell, D. Neale, R. Wickneswari
1. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia
2. The James Hutton Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK
... The promoter regions were analysed using Softberry-TSSP (http://linux1.softberry.com/
berry.phtml) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/
html) programmes to predict the core ele- ments in the promoters. ...
Plant Molecular Biology Reporter
May 2013 DOI: 10.1007/s11105-013-0603-2
Molecular Cloning and Characterization of a Trichome-Specific Promoter of Artemisinic Aldehyde ?11(13) Reductase (DBR2) in Artemisia annua
Jiang et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were
analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE
software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...
Protoplasma
Volume 250, Issue 2 , pp 565-576 DOI:10.1007/s00709-012-0442-2
Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum
Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Further the upstream flanking region was used for identification of RNA pol II binding site
and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml?
Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...
Protoplasma
Volume 250, Issue 1 , pp 333-345 DOI:10.1007/s00709-012-0417-3
Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera
Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding
site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml?
topic0tssp&group0 programs&subgroup0promoter) database. ...
Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 114, Issue 3 , pp 373-383 DOI:10.1007/s11240-013-0332-0
Petal-specific activity of the promoter of an anthocyanidin synthase gene of tobacco (Nicotiana tabacum L.)
Lim et al.,
1. National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Republic of Korea
2. Department of Genetic Engineering and Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Republic of Korea
... The 5?-upstream region was analyzed using the PLACE (http://www.dna.affrc.go.jp/PLACE/
signalscan.html), PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and
Softberry (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup ...
Functional & Integrative Genomics
Volume 13, Issue 2 , pp 167-177 DOI:10.1007/s10142-013-0310-y
A root-specific wall-associated kinase gene, HvWAK1, regulates root growth and is highly divergent in barley and other cereals
Ravneet Kaur, Kashmir Singh, Jaswinder Singh
1. Plant Science Department, McGill University, 21 111 Rue lakeshore, Ste Anne de Bellevue, QC, H9X 3V9, Canada
... 1999) and TSSP program (prediction of plant promoters, RegSite Plant DB, Softberry Inc.). ...
1). Various motifs and transcriptional factor binding sites were predicted using both the
programs against the Softberry Regsite-Plant and PLACE databases. ...
Plant Physiology
June 2013 vol. 162 no. 2 885-896 DOI:10.?1104/?pp.?113.?214700
The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear
Wang et al.,
Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China (Z.W., D.M., TZ.L.)
Research Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)
Shenyang Agricultural University, Shenyang 110866, China (A.W., TL.L.); and
Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Germplasm Resources Utilization), Ministry of Agriculture, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)
... name proPcMYB10 (JX403962). It contained a core promoter at position ?60 bp
and an enhancer promoter at position ?675 bp (as analyzed by TSSP software on
softberry; http://linux1.softberry.com/berry.phtml). Besides the ...
Gene
Volume 531, Issue 1, 15 November 2013, Pages 15–22 DOI:10.1016/j.gene.2013.08.060
Identification of abiotic stress miRNA transcription factor binding motifs (TFBMs) in rice
Rama Devi et al.,
a Crop Improvement section, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India
b Department of Statistics, Acharya N. G. Ranga Agricultural University, Rajendranagar, Hyderabad 500030, India
... org/gb2/gbrowse/maize_v2/). The TSS and TATA-box predictions were made using
TSSP web tool (http://linux1.softberry.com/berry.phtml? topic = tssp& group =
programs&subgroup = promoter). Putative promoter sequences ...
Journal of Integrative Agriculture
Volume 12, Issue 6, June 2013, Pages 962–970 DOI:10.1016/S2095-3119(13)60473-6
Molecular Cloning and Characterization of a Novel Gene Involved in Fatty Acid Synthesis in Brassica napus L
XIAO et al.,
a The Oil Crops Research Institute/National Oil Crops Improvement Center, Changsha 410128, P.R. China
b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, P.R. China
... pI and MW were predicted using the DNAMAN program. Promoter prediction was performed
on the SoftBerry TSSP (http://linux1.softberry. com/berry.phtml) and Berkeley Neural Network
Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. ...
J. Agric. Food Chem.
2013, 61 (18), pp 4396–4405 DOI: 10.1021/jf400776m
Differential Expression of Genes Encoding Acid Invertases in Multiple Shoots of Bamboo in Response to Various Phytohormones and Environmental Factors
Shu-Chien Liao †, Choun-Sea Lin ‡, Ai-Yu Wang *†, and Hsien-Yi Sung *†
† Department of Biochemical Science and Technology, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan
‡ Agricultural Biotechnology Research Center, Academia Sinica, No. 128, Sec. 2, Academia Road, Nankang, Taipei 115, Taiwan
... Sequence Analysis The potential transcription initiation site and the putative regulatory
cis-elements and conserved motifs were analyzed using the online TSSP program
(http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) and ...
PloS one
August 08, 2013DOI: 10.1371/journal.pone.0071435
Characterization and Evolution of Conserved MicroRNA through Duplication Events in Date Palm (Phoenix dactylifera)
Xiao et al.,
Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan, China
School of Agriculture and Food Sciences and Centre for Integrative Legume Research, The University of Queensland, Brisbane, Australia
... Similarities between duplicated pre-miRNA sequences were analyzed by Blast2. Promoters
(TATA box) and enhancers of miRNA genes were predicted from regions 1 kb upstream of
pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...
J. Exp. Bot.
(2013) 64 (11): 3299-3312. doi: 10.1093/jxb/ert183
Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts
Wen et al.,
The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Center, and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095 Jiangsu, China
... Positive clones were sequenced at Takara Bio, Inc., Dalian, China. Basic sequence analysis
was conducted with Macvector 10.0 (Accelrys, Oxford, USA). The transcription start site (TSS)
was predicted with the plant promoter prediction program TSSP (http://www.softberry.com). ...
Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1089-1099 DOI:10.1007/s11105-013-0578-z
LtuCAD1 Is a Cinnamyl Alcohol Dehydrogenase Ortholog Involved in Lignin Biosynthesis in Liriodendron tulipifera L., a Basal Angiosperm Timber Species
Xu et al.,
1. Department of Genetics and Biochemistry, Clemson University, 130 McGinty Court, Robert F. Poole Agricultural Center, Room 153, Clemson, SC, 29634, USA
2. Bioenergy Systems Research Institute, University of Georgia, Athens, GA, 30602, USA
... The TSSP/Prediction of Plant Promoters (Solovyev and Shahmuradov 2003) (http://
softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) was used
to predict the potential Plant Mol Biol Rep Page 4. transcription start site. ...
Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0656-2
Characterization of the Promoter of Artemisia annua Amorpha-4,11-diene Synthase (ADS) Gene Using Homologous and Heterologous Expression as well as Deletion Analysis
Zhu et al.,
1. Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Laboratory of Plant Biotechnology, College of Life and Environment Sciences, Shanghai Normal University, Shanghai, 200234, People’s Republic of China
... As TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=
promoter) predicted, three promoter/enhancer(s) are located at 2868 LDF-, 1247 LDF-, and 774
LDF-, respectively; the 2868 LDF- site is then considered as the transcription start site (+1 ...
Plant Pathology
doi: 10.1111/ppa.12155
Construction of a cassava PR protein-interacting network during Xanthomonas axonopodis pv. manihotis infection.
Roman et al.,
Manihot-Biotec Group, Department of Biology, Universidad Nacional de Colombia, Bogota D.C, Colombia
... For analysis of the promoter regions, 2 kp of upstream sequence of the HEV, CHI, SiR
genes, 18 HEV interactors, five CHI interactors and a SiR interactor, were used in the
tssp program (http://linux1.softberry.com/berry.phtml). Results. ...
Planta
Volume 237, Issue 6 , pp 1495-1508 DOI:10.1007/s00425-013-1860-x
Polymorphism of TaSAP1-A1 and its association with agronomic traits in wheat
Chang et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... A putative transcription start site (TSS) was identified at ?1,030 bp using the TSSP
software available at site http://www.softberry.com (Fig. 1b). Fig. 1 a Isolation of the
sequence surrounding TaSAP1 using primer pair Sap2F and Sap2R. ...
PloS one
November 22, 2013DOI: 10.1371/journal.pone.0080643
Studies on the Expression of Sesquiterpene Synthases Using Promoter-b-Glucuronidase Fusions in Transgenic Artemisia annua L
Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
Department of Chemistry and Biomedicine, Linnaeus University, Kalmar, Sweden
... The transcription start site (TSS) (labeled +1) of the cloned promoters was predicted using the
TSSP software (http://linux1.soft-berry.com/berry.phtml) as summarized in Table 2. Using the
PLACE (http://www.dna.affrc.go.jp/PLACE/) and PlantCARE (http://bioinformatics.psb.ugent ...
New Phytologist
198: 1191–1202. doi: 10.1111/nph.12207
AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea
Lu et al.,
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China
... To examine the expression pattern of AaORA in detail, we cloned an 1193-bp promoter sequence
(JQ797714) of AaORA by genomic walking. The transcription start site (TSS) of the cloned
promoter was predicted using TSSP software (http://linux1.softberry.com/berry.phtml). ...
Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI:10.1007/s11033-012-2169-8
Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree
Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter)
program pre- dicted promoter position has been numbered ?1 and the upstream sequences have
been numbered from -1 whereas the downstream nucleotides have been ...
Journal of Genetics,
Vol. 91, No. 3, December 2012
Genomewide analysis of intronic microRNAs in rice and Arabidopsis
G. D. YANG, et al.,
State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University,
Tai’an, Shandong 271018, People’s Republic of China
... The upstream sequences were anal- ysed by two popular promoter prediction tools
for plant genes: TSSP (http://linux1.softberry.com/) and Promoter Scan (http://www-
bimas.cit.nih.gov/molbio/proscan/) with the default parameters. ...
J. Exp. Bot.
(2012) 63 (17): 6267-6281.
doi: 10.1093/jxb/ers278
GbTCP, a cotton TCP transcription factor, confers fibre elongation and root hair development by a complex regulating system
Juan Hao et al.,
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China
... Gene-specific primers were designed for genome walking (Supplementary Table S1), and
promoter prediction software TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group=
programs&subgroup=promoter) was used to predict the GbTCP transcription initiation site. ...
Functional & Integrative Genomics
November 2012, Volume 12, Issue 4, pp 649-658 DOI: 10.1007/s10142-012-0282-3
Novel miRNAs in the control of arsenite levels in rice
Qingpo Liu
1. College of Agriculture and Food Science, Zhejiang A & F University, Lin’an, Hangzhou, 311300, People’s Republic of China
... al. (2007). If the pre-miRNAs were located in intronic or exonic regions, the upstream
sequences of the host genes were adopted. The software TSSP (http://linux1.softberry.
com/berry.phtml? topic0tssp&group0programs&subgroup0promoter ...
Molecular Biotechnology
10.1007/s12033-012-9583-y
Efficient Regeneration Potential is Closely Related to Auxin Exposure Time and Catalase Metabolism During the Somatic Embryogenesis of Immature Embryos in Triticum aestivum L
She et al.,
1. Key Laboratory of Crop Genetics and Breeding, Ministry of Agriculture, National Key Facility of Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China
2. National Key Facility of Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Zhong Guan Cun South St, Haidian District, Beijing, 100081, China
... ugent.be/webtools/plantcare/html/, Lescot et al. [36]). TSSP software was used to predict
TATA-box and transcriptional start site (TSS) (http://linux1.softberry.com/berry.phtml?
topic= tssp&group=programs&subgroup=promoter). Results ...
BMC Plant Biology
2012, 12:155 doi:10.1186/1471-2229-12-155
Intraspecific sequence comparisons reveal similar rates of non-collinear gene insertion in the B and D genomes of bread wheat
Bartos et al.,
1 Centre of the Region Hana for Biotechnological and Agricultural Research, Institute of Experimental Botany, Sokolovska 6, Olomouc, CZ-77200, Czech Republic
2 Institute of Molecular Genetics, Videnska 1083, Praha, CZ-14220, Czech Republic
... We extracted 1 kb sequence upstream to start codon for each coding sequence found at 3DS-
and 3B-specific loci. We predicted polymerase II promoters, transcription start sites and
TATA-box positions using TSSP [31] at http://linux1.softberry.com/berry.phtml webcite. ...
Plant Molecular Biology
Volume 81, Issue 1-2 , pp 119-138 DOI: 10.1007/s11103-012-9986-y
Trichome-specific expression of the amorpha-4,11-diene 12-hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisinin biosynthesis in Artemisia annua, as reported by a promoter-GUS fusion
Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
1. School of Natural Sciences, Linnaeus University, 39182, Kalmar, Sweden
... At present, we cannot conclude if the four cyp71av1 genes encode proteins of different
length. Attempts to predict the transcription start site (TSS) of the cyp71av1 promoters using
the TSSP software (http://linux1.softberry.com/berry.phtml) failed. ...
Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI: 10.1007/s11033-012-2169-8
Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree
Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter)
program pre- dicted promoter position has been numbered ?1 and the upstream sequences have
been numbered from -1 whereas the downstream nucleotides have been ...
PLoS ONE
7(9): e46021. doi:10.1371/journal.pone.0046021
A Candidate-Gene Association Study for Berry Colour and Anthocyanin Content in Vitis vinifera L.
Cardoso S, Lau W, Eiras Dias J, Fevereiro P, Maniatis N
1 Laboratory of Plant Cell Biotechnology, Instituto de Tecnologia Quimica e Biologica, Oeiras, Portugal, 2 Department of Genetics, Evolution and Environment, University College London, London, United Kingdom,
... promoter region. According to the TSSP promoter prediction program for plant genes
available on SoftBerry network server (http://www.softberry.com), s90 is located only
4 bp upstream of the transcription start site (TSS). Two ...
Protoplasma
May 2012 DOI
10.1007/s00709-012-0417-3
Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera
Himanshu Tak hsjtak@barc.gov.in (1)
Minal Mhatre minalmhatre@yahoo.com (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding
site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml?
topic0tssp&group0 programs&subgroup0promoter) database. ...
Biologia Plantarum
Volume 56, Issue 4 , pp 699-704 DOI
10.1007/s10535-012-0132-0
Salt- and osmotic stress-induced choline monooxygenase expression in Kochia scoparia is ABA-independent
E. B. Kalinina (1)
B. K. Keith (1)
A. J. Kern (2)
W. E. Dyer (1)
1. Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT, 59717, USA
2. Department of Biology, Northland College, Ashland, WI, 54806, USA
... was conducted by Geneway Company (Hayward, CA, USA) using lambda forward and reverse
primers (Promega) and sequence-specific primers designed using Primer3 software (Table 1).
Canonical promoter sequences were identified using the Softberry TSSP package ...
Protoplasma
August 2012 DOI
10.1007/s00709-012-0442-2
Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum
Himanshu Tak (1)
Minal Mhatre (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Further the upstream flanking region was used for identification of RNA pol II binding site
and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml?
Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...
BMC Plant Biology
2012, 12:166 doi:10.1186/1471-2229-12-166
The study of two barley Type I-like MADS-box genes as potential targets of
epigenetic regulation during seed development
Aliki Kapazoglou et al.,
1 Institute of Agrobiotechnology (INA), CERTH, Thermi-Thessaloniki GR-
57001, Greece
2 Department of Genetics and Plant Breeding, Aristotle University of
Thessaloniki, Thessaloniki GR-54124, Greece
... The prediction of the putative cis acting elements was accomplished using the TSSP /Prediction
of PLANT Promoters algorithm (Using RegSite Plant DB, Softberry Inc.) in the SoftBerry database
(http://linux1.softberry.com/cgi-bin/programs/promoter/tssp.pl) and PlantCARE ...
Plant Molecular Biology Reporter
June 2012, Volume 30, Issue 3, pp 556-565 DOI
10.1007/s11105-011-0364-8
The Role of a Gibberellin 20-Oxidase Gene in Fruit Development in Pepper (Capsicum annuum)
Aphrodite Tsaballa (1)
Konstantinos Pasentsis (2)
Athanasios S. Tsaftaris (1) (2)
1. Department of Genetics and Plant Breeding, School of Agriculture, Aristotle University of Thessaloniki, Thessaloniki, 541 24, Greece
2. Institute of Agrobiotechnology (INA), CERTH, 6th km Charilaou-Thermis Road, Thermi, 570 01, Greece
... quenced several times with diverse primer sets. The analysis of the 5? upstream
sequences was done using the TSSP/ Prediction of PLANT Promoters application
at Softberry (http://linux1.softberry.com/berry.phtml). Based ...
African Journal of Biotechnology
Vol.10 . (55), pp. 11477-11482, 21 September, 2011 DOI:
Characterization of upstream sequences from the 8S globulin gene of Vigna radiata
Yue-Ning Yang et al.,
Department of Biotechnology, Jinan University, Guangzhou 510632, China.
... PLACE (http://www.dna.affrc.go.jp/database/) was used for transcription elements prediction;
while transcription start site and TATA box were predicted with software TSSP (prediction of
start of transcription sequences) of Softberry (http://www.softberry.com). ...
PLoS ONE
(2011), 6(12): e28073. doi:10.1371/journal.pone.0028073
Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model.
Zhang Y, Jiang W-k, Gao L-z
Plant Germplasm and Genomics Center, Kunming Institute of Botany, The Chinese Academy of Sciences, Kunming, China, Graduate School, Chinese Academy of Science, Beijing, China
... Promoters (TATA box) and enhancers of miRNA genes were
identified from upstream 1 kb regions of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...
Plant Cell Rep.
2011 Apr;30(4):539-49. doi: 10.1007/s00299-010-0964-z.
Isolation and characterization of a rice glutathione S-transferase gene promoter regulated by herbicides and hormones
Hu et al.,
Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, 400044 Chongqing, People's Republic of China
... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml)
and Berkeley Neural Network Promoter Prediction (http:// www.fruitfly.org/seq_tools/promoter.
html) web servers. Construction of OsGSTL2 promoter::GUS fusions ...
Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1336–1345
In silico Detection of Novel MicroRNAs Genes in Soybean Genome
Yong-xin LIU a, *, , , Wei CHANG a, *, Ying-peng HAN a, Quan ZOU b, Mao-zu GUO c, Wen-bin LI a
a Key Laboratory of Soybean Biology, Chinese Ministry of Education/Soybean Research Institute, Northeast Agricultural University, Harbin 150030, P.R.China
b School of Information Science and Technology, Xiamen University, Xiamen 361005, P.R.China
. al. 2005). TSSP of Softberry was adopted for supplemental predictions (http://www.
Softberry.com, Solovyev and Shahmuradov 2003). The distribution of novel miRNAs
was analyzed by Mapchart 2.1 (Voorrips 2002). Furthermore ...
Theoretical and Applied Genetics
Volume 122, Issue 1 , pp 211-223 DOI: 10.1007/s00122-010-1437-z
Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.)
Zhenqi Su, Chenyang Hao, Lanfen Wang, Yuchen Dong, Xueyong Zhang
1. Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... The promoter elements were identified using the TSSP program (http://www.softberry.
com). ... The core elements of the promoter were predicted with the TSSP program (http://
www.softberry.com), and the TATA box was identified at ...
Plant Cell Reports
Volume 30, Issue 12 , pp 2187-2194 DOI: 10.1007/s00299-011-1124-9
Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential ‘Sorbonne’
Liu et al.,
1. College of Forestry, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China
3. Key Laboratory of Horticulture Plant Germplasm Utilization in Northwest China of Ministry of Agriculture, Yangling, 712100, Shaanxi, People’s Republic of China
... DQ471951). The putative transcription start site (TSS), predicted by the Softberry database
(http://linux1. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter),
is located at 46 bp upstream of the ATG translation start codon. ...
Journal of Integrative Plant Biology
53: 814–823. doi: 10.1111/j.1744-7909.2011.01070.x
Induced Pib Expression and Resistance to Magnaporthe grisea are Compromised by Cytosine Demethylation at Critical Promoter Regions in Rice.
Li et al.,
1 Key Laboratory of Molecular Epigenetics of MOE and The Institute of Genetics & Cytology, Northeast Normal University, Changchun 130024, China
2 Department of Agronomy, Jilin Agricultural University, Changchun 130118, China
... By a computational program Softberry-TSSP (http://www.softberry.com), two TATA boxes at
positions 1 995 nt and 3 496 nt respectively, and two putative enhancers at positions 1 350 nt
and 3 630 nt respectively, were identified (Figure 2, upper panel), further verifying its identity ...
The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x
A soybean
Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China
... accession number FJ461673). In silico analysis of the promoter sequence was
performed using the software programs tssp-tcm (Shahmuradov et al., 2005),
nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...
American Journal of Plant Sciences
Volume 2 Issue 4 Pages: 619-628 2011 DOI: 10.4236/ajps.2011.24073
Trichome-Specific Expression of Amorpha-4,11-Diene Synthase, a Key Enzyme of Artemisinin Biosynthesis in Artemisia annua L., as Reported by a Promoter-GUS Fusion
H Wang, L Olofsson, A Lundgren
Linnaeus University, Faculty of Science and Engineering, School of Natural Sciences
... The transcription start site (TSS) of the cloned promoter was predicted using the TSSP software
(http://linux1. softberry.com/berry.phtml). A putative TSS of ADS (la- beled +1 in Figure 1) was
predicted 51 bp upstream of the translation initiation ATG-codon. ...
Mol. Plant
(2011) 4 (2): 300-309. doi: 10.1093/mp/ssq076
Characterization of Xanthomonas oryzae-Responsive cis-Acting Element in the Promoter of Rice Race-Specific Susceptibility Gene Xa13
Ting Yuan, Xianghua Li, Jinghua Xiao and Shiping Wang 1
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... Promoter Sequence Analysis. The TATA boxes of promoters P Xa13 and P xa13 were predicted
using the computer programs TSSP provided at the Softberry website (www.softberry.com) and
PROSCAN (http://bimas.dcrt.nih.gov/molbio/proscan). Statistical Analysis. ...
Molecular Biology Reports
2011, Volume 38, Issue 6 , pp 4023-4035 DOI: 10.1007/s11033-010-0521-4
Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells
Upendra K. Singh Shekhawat, Thumballi R. Ganapathi, Lingam Srinivas
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Also, a 76 nucleotide long 50 UTR has been pre- dicted based on the sequence of
50 end of the EST DN239172 and the analysis of 50 proximal sequence (obtained
using TAIL-PCR) by TSSP program hosted at www.softberry.ru. ...
Journal of Plant Physiology
Volume 167, Issue 12, 15 August 2010, Pages 1003-1008 doi:10.1016/j.jplph.2010.01.021
Expression of the 26S proteasome subunit RPN10 is upregulated by salt stress in Dunaliella viridis
Xiaobin Sun a, 1, Xiangzong Meng b, 1, Zhengkai Xu a, b and Rentao Song a
a Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, Shanghai 200444, China
b Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China
... gov/BLAST/). Gene prediction was carried out using SoftBerry TSSP (http://www.
softberry.com/berry.phtml?topic=ann2) and GENSCAN (http://genes.mit.edu/
GENSCAN.html) (Burge and Karlin, 1997). Sequence alignments ...
Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x
Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)
Xia YANG 1,
Hong CUI 2,
Zu-Li YUAN 2,
Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China
2 Henan Agricultural University, Zhengzhou 450002, China
... To predict the promoter regions and the transcription start sites, genomic regions upstream of
the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region
and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ...
Plant Physiology
153:1239-1249 (2010) First published online May 3, 2010; 10.1104/pp.110.157123
Identification and Application of a Rice Senescence-Associated Promoter
Liu et al.,
National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, People's Republic of China (L.L., Y.Z., X.L., Y.L.); Department of Plant Sciences, University of California, Davis, California 95616 (L.L., M.W.S.)
... sativa sp. japonica). The promoter region of this gene was predicted using the software
TSSP, provided at the Softberry Web site (http://linux1.softberry.com/berry.phtml?topic%
810%867=case_study_plants). The regulatory elements ...
Gene
Volume 459, Issues 1-2, 1 July 2010, Pages 24-31 doi:10.1016/j.gene.2010.03.009
Molecular characterization and methylation study of matrix gla protein in articular cartilage from pig with osteochondrosis
Helga Sauerwein, Karl Schellander
a Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Germany
b Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand
... was performed by the CEQ8000 sequencer system (Beckman Coulter). A sequence
of transcription start site (TSS) was predicted using TSSP (http://www.softberry.ru).
The published sequences (NC_010447) of the 5?-flanking ...
Genome
Volume 53, Number 7, 1 July 2010 , pp. 533-544(12)
Comparison of gene order of GIGANTEA loci in yellow-poplar, monocots, and eudicots
Liang Haiying; et al.,
... 2006). Exon–intron splice sites, start codons, and transcription start sites were predicted by
NetPlantGene (Hebsgaard et al. 1996), NetStart 1.0 (Ped- ersen and Nielsen 1997), and the
TSSP engine developed by SoftBerry (Solovyev and Shahmuradov 2003), respec- tively. ...
Plant Science
Volume 179, Issue 4, October 2010, Pages 390-398 doi:10.1016/j.plantsci.2010.06.018
Comparison of gene order in the chromosome region containing a TERMINAL FLOWER 1 homolog in apricot and peach reveals microsynteny across angiosperms
Haiying Liang et al.,
a Department of Genetics and Biochemistry, Clemson University, Clemson, SC 29634, United States
b Department of Horticulture, University of Georgia, Athens, GA 30602, United States
... Exon/intron splicing sites were determined by aligning with a full-length coding
sequence obtained from the peach cultivar Springprince . Transcription start sites
were predicted by TSSP engine developed by SoftBerry [39]. ...
Planta
2010 Apr;231(5):1211-27. Epub 2010 Mar 6 DOI: 10.1007/s00425-010-1127-8
Identification and organization of chloroplastic and cytosolic L-myo-inositol 1-phosphate synthase coding gene(s) in Oryza sativa: comparison with the wild halophytic rice, Porteresia coarctata
Ray et al.,
Plant Molecular and Cellular Genetics, Bose Institute (Centenary Campus), Kolkata, India
... 1999) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/html/). Predictions
of eukaryotic promoter and transcription initiation sites were performed using the TSSP/Prediction
of PLANT Promoters (Using RegSite Plant DB, Softberry Inc.). ...
J. Exp. Bot.
2010 61 (11): 2991-3002. doi: 10.1093/jxb/erq124
Cold acclimation and low temperature resistance in cotton: Gossypium hirsutum phospholipase Da isoforms are differentially regulated by temperature and light
Kargiotidou A, Kappas I, Tsaftaris A, Galanopoulou D, Farmaki T.
1Institute of Agrobiotechnology, Centre for Research and Technology, 6th km Charilaou - Thermi Rd. 570 01, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki 54006, Greece
... Promoter prediction of GrPLD and GaPLD The TSSP (promoter prediction program
for plant genes), http://linux1.softberry.com/berry.phtml (Shahmuradov et al., 2005)
was used. A promoter was predicted for GrPLD and GaPLD . ...
Methods Mol Biol.
2010;592:149-61
MicroRNA promoter analysis
Megraw M, Hatzigeorgiou AG
Department of Genetics, Center for Bioinformatics, School of Medicine, University of Pennsylvania, Philadelphia, PA, USA
... events. 3. The first cited source provides a web-based interface that accepts regions
of sequence for promoter prediction (http:// softberry.com/berry.phtml?topic =
tssp&group = programs& subgroup = promoter). The second
The Plant Cell
22:349-363 (2010) 10.1105/tpc.108.064816
The Arabidopsis thaliana STYLISH1 Protein Acts as a Transcriptional Activator Regulating Auxin Biosynthesis
Eklund et al.,
a Department of Plant Biology and Forest Genetics, Uppsala BioCenter Swedish University of Agricultural Sciences, 750 07 Uppsala, Sweden
b Research Institute of Genome-Based Biofactory, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8562, Japan
... The yeast one-hybrid analysis showed the ability of STY1 to bind a 207-bp region directly
upstream of a predicted TATA box (YUC4-1; TSSP at http://www.softberry.com/berry.phtml) but
not to DNA from the more proximal promoter region or the presumptive 5' untranslated ...
Planta
Volume 230, Number 5 / October, 2009, pp. Volume 230, Number 5 / October, 2009
Genome-wide survey of rice microRNAs and microRNA–target pairs in the root of a novel auxin-resistant mutant
Meng et al.,
(1) State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China
(2) Department of Bioinformatics, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China
... Both the transcription start site (TSS) and the TATA-box in miRNA promoters were
searched by using TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group=
programs& subgroup=promoter) (Shahmuradov et al. 2003). ...
Plant Production Science
Vol. 12 (2009) , No. 3 341-344
Genetic Transformation of a High Molecular Weight Glutenin (Glu-1Dx5) to Rice cv. Fatmawati
Yoshiharu Wada 2), Nono Carsono 1), Anas 1), Ly Tong 2) and Tomohiko Yoshida 2)
1) Faculty of Agriculture, Padjadjaran University
2) Faculty of Agriculture, Utsunomiya University
... To confirm the existence of the promoter in the full-length of 8.2 kb Glu- 1Dx5, we examined the
DNA sequence with TSSP- Prediction of Plant Promoter Software (Softberry Inc.), and found at
least 4 promoters or enhancers on the basis of TATA box prediction, suggesting that ...
BMC Plant Biol.
2009 Jul 17;9:93.
Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.
Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.
... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter
recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih.
gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...
BMC Plant Biology
2009, 9:126 doi:10.1186/1471-2229-9-126
Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae
Francois Fauteux, Martina V Stromvik
1
Department of Plant Science, McGill University, Ste-Anne-de-Bellevue, Canada
2
McGill Centre for Bioinformatics, McGill University, Montre'al, Canada
... literature [20, 35, 60-77]. The transcription start sites were predicted in 13 promoters for which
transcriptional start data was unavailable in GenBank or literature, using the TSSP software
from Softberry Inc. (http://www.softberry.ru). One representative ...
Plant Tissue Cult. & Biotech.
18(2): 123-130, 2008 (December)
Identification of Drosophila Promoter Using Positional
Differential Matrix and Support Vector Machine from
Sequence Data
Azizul Haque et al.,
Institute of Information Technology, University of Dhaka, Dhaka-1000, Bangladesh
... Program used (%) NNPP threshold (0.8) SoftBerry (TSSP) ProScan Vers. 1.7 Dragon Pro?moter
Finder Vers. 1.4 Promoter 2.0 Pred. Server ... The proposed method exhibits better accuracy
compared to other two methods NNPP (Reese et al. 1996) and SoftBerry(TSSP). ...
Plant Biotechnology
25, 000–000 (2008)
Genome-wide comparative analysis of Oryza sativa (japonica)
and Arabidopsis thaliana 5 -UTR sequences for translational
regulatory signals
M. Shashikanth, A. R. Krishna, G. Ramya, Geeta Devi, K. Ulaganathan
Center for Plant Molecular Biology, Osmania University, Hyderabad-500007, A. P., India
... 5 -UTR-genomic sequences longer than 150 base pairs were submitted to the promoter
finding tool, TSSP (Softberry), available online at http://www.softberry.com ...
Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065
Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)
Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece
... elements was performed using the database available at: http://softberry.com. TSSs
were determined using the TSSP program available at the site. NSITE-PL was ...
New Phytologist
2008 Volume 179 Issue 3, Pages 722 - 737
Comparative analysis of orthologous cellulose synthase promoters from Arabidopsis, Populus and Eucalyptus: evidence of conserved regulatory elements in angiosperms
Nicole Marie Creux, Martin Ranik, David Kenneth Berger and Alexander Andrew Myburg
1 Department of Genetics , 2 Department of Plant Science, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South Africa
... The transcriptional start site (TSS) prediction program, TSSP (Shahmuradov et al.,
2005, available at http://www.softberry.com), is trained on plant promoters ...
BMC Bioinformatics
2008, 9:414 doi:10.1186/1471-2105-9-414
Pol II promoter prediction using characteristic 4-mer motifs: a
machine learning approach
Firoz Anwar et al.,
Department of Computer Science and Engineering, East West University, Bangladesh, 2Department of Genetic Engineering and
Biotechnology, University of Dhaka, Bang
... Other prominent promoter prediction tools use either a statistical approach
or Neural Network such as SoftBerry (TSSP). However, ...
Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia
... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters
(using the RegSite plant database, Softberry, http://www.softberry.com). ...
Gene
Volume 409, Issues 1-2, 15 February 2008, Pages 1-10
Molecular evolution of the MLO gene family in Oryza sativa and their functional divergence
Qingpo Liua
and Huiqin Zhu
School of Agriculture and Food Science, Zhejiang Forestry University, Hangzhou, Lin'an 311300, PR China
bDepartment of Agronomy, Zhejiang University, Hangzhou 310029, PR China
cDepartment of Agronomy, Qinghai University, Xining 810003, PR China
... Further, we have identified promoters for OsMLOs using the plant promoter
prediction program TSSP that was developed by Softberry Inc. ...
TAG Theoretical and Applied Genetics
Volume 116, Number 2 / January, 2008 Pages 179-192
Does sequence polymorphism of FLC paralogues underlie flowering time QTL in Brassica oleracea?
H. Razi, E. C. Howell, H. J. Newbury and M. J. Kearsey
(1) School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK
(2) Department of Crop Production and Plant Breeding, College of Agriculture, Shiraz University, Shiraz, 71441-65186, Iran
... Higo et al. 1999), the TSSP (Softberry, http://www.soft- berry.com) and the
TSSP-TCM (Shahmuradov et al. 2005). Results The B. oleracea ...
Plant, Cell & Environment
Volume 31 Issue 1 Page 86-96, January 2008
Identification of novel pathogen-responsive cis-elements and their binding proteins in the promoter of OsWRKY13, a gene regulating rice disease resistance
MENG CAI et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... The promoter region of OsWRKY13 was predicted with the computer programs TSSP provided
at the Softberry website (http://www.softberry.com), and PROSCAN (http ...
Genetics
Vol. 176, 2541-2549, August 2007
The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus
Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences,
South China Agricultural University, Guangzhou, 510642, China and
Key Biotechnology Laboratory of State Ethnic Affairs Commission,
College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China
... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH,
respectively (http://www.softberry.com/berry.html). ...
PLoS Comput Biol
2007, 3(3): e37 doi:10.1371/journal.pcbi.0030037
Characterization and Identification of MicroRNA Core Promoters in Four Model Species
Zhou X, Ruan J, Wang G, Zhang W
Department of Computer Science and Engineering, Washington University in Saint Louis, Saint Louis, Missouri, United States of America, Department of Genetics, Washington University in Saint Louis, Saint Louis, Missouri, United States of America
... In comparison, TSSP (SoftBerry, http: / /www.softberry.com), which is one of the
best promoter prediction methods for plants, only identified 39 (60 ...
Plant Biotechnology Journal
5 (5), 664–674
A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific
gene expression in transgenic plants
Meng Cai, Jun Wei, Xianghua Li, Caiguo Xu, Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Centre of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... The promoter region of D54O was predicted using the computer programs TSSP, provided
at the Softberry website (http://www.softberry.com), and PROSCAN (http ...
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
Journal of Zhejiang University - Science B
August 27, 2007 pp. 661-665
Cloning, sequencing and expression analysis of the NAR promoter activated during hyphal stage of Magnaporthe grisea
Lu Jian-ping Contact Information, Duan Zhi-bing , Liu Tong-bao and Lin Fu-cheng
Department of Biology, School of Life Sciences, Zhejiang University, Hangzhou, 310058, China
Biotechnology Institute, Zhejiang University, Hangzhou, 310029, China
... fruitfly.org/seq_tools/promoter.html, version 2.2), TSSP (http://www.softberry.com/
berry.phtml, pre- diction of plant promoters), and TFSCAN (http:// bioweb ...
Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)
Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene
Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming
... 2002; Takai and Jones 2003) for CpG island prediction; TSSP (http://www.
softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) for plant ...
The Plant Cell
18:2929-2945 (2006)
The Balance between the MIR164A and CUC2 Genes Controls Leaf Margin Serration in Arabidopsis
Krisztina Nikovicsa et al.,
Laboratoire de Biologie Cellulaire, Institut Jean Pierre Bourgin, Institut National de la Recherche Agronomique, 78026 Versailles Cedex, France
...Analysis of the pri-miRNAs
We performed 3' and 5' RACE for each gene with the GeneRacer cDNA amplification kit (Invitrogen).
We used two or three rounds of nested PCR to amplify the 3' and 5' ends of the three pri-miR164s.
The miR164A-15, miR164A-17, and miR164A-18 primers were used for the 3' end of pri-miR164A,
and miR164A-16 and miR164A-7 were used for the 5' end. The miR164B-13, miR164B-15,
and miR164B-16 primers were used for the 3' end of pri-miR164B, and miR164B-5 and miR164B-14
were used for the 5' end. We used miR164A-15 and miR164C-1 for the 3' end of pri-miR164A and
miR164C-3 and miR164C-5 for the 5' end. Following gel electrophoresis, RACE reaction products
were inserted into the pGEM-T Easy vector (Promega), and the two strands were sequenced.
Two to four independent 5' clones and 5 to 10 independent 3' clones were analyzed for each gene.
Promoter and transcription start sites were predicted by
the TSSP program ( http://www.softberry.com/berry.phtml?topic=tsspandgroup=programsandsubgroup=promoter).
The pri-miRNA secondary structure was determined with the Mfold program
(Mathews et al., 1999; Zuker, 2003) ( http://www.bioinfo.rpi.edu/applications/mfold/old/rna/)....
Genetica
(2006), 128, 395-407
Isolation and characterization of a novel semi-lethal Arabidopsis thaliana mutant of gene for pentatricopeptide (PPR) repeat-containing protein
Tomas Kocabek, Jana Repkova, Marketa Dudova, Klara Hoyerova and Lukas Vrba
Institute of Plant Molecular Biology, Biological Centre of the Academy of Sciences of the Czech Republic,
Branisovska 31, CZ-370 05 Ceske Budejovice, Czech Republic
Applied TSSP software... TSSP-TCM software suitable for plant pro-. moters searching (Shahmuradov et al. ...
Plant Science
Volume 168, Issue 6, June 2005, Pages 1571-1579
Functional analysis of GUS expression patterns and T-DNA integration characteristics in rice enhancer trap lines
Peng et al.,
Biotechnology Research Institute, The Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... promoter systems, rice genomic sequences located upstream the GAL4/VP16-UAS apparatus
were used for promoter prediction analysis (TSSP, http://www.softberry.com
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1731, Issue 3, 20 December 2005, Pages 202-208
T-DNA tagging and characterization of a cryptic root-specific promoter in Arabidopsis
C. Sivanandan, T.P. Sujatha, Anand Mohan Prasad, R. Resminath, Dhiraj R. Thakare, S.R. Bhat and Srinivasan
National Research Center on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110012, India
... using a web-based program, Plant Cis-Acting Regulatory Elements (Plant CARE) [21]
and TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc ...
BMC Bioinformatics
2005 6:114 doi:10.1186/1471-2105-6-114
CAGER: classification analysis of gene expression regulation using multiple information sources
Jianhua Ruan and Weixiong Zhang
1Department of Computer Science and Engineering, Washington University, St. Louis, MO 63130, USA and Department of Genetics,
Washington University School of Medicine, St. Louis, MO 63110, USA
... For Arabidopsis ORFs, the upstream sequences were used as inputs to a promoter prediction program, TSSP [63],
to predict transcription start sites (TSSs). ...
Bioinformatics
2005 21(14):3074-3081
Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana
Weixiong Zhang et al.,
Department of Computer Science and Engineering, Washington University in Saint Louis Saint Louis, MO 63130, USA
... sites (TSSs). To predict TSSs, we combined an A.thaliana cDNA database and a software, TSSP (SoftBerry, http://www.softberry.com). As ...
Acta Biochimica Polonica
Vol. 52 No. 1/2005 117-128
Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol)
lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits
Frantz Liszewska, Dali Gaganidze and Agnieszka Sirko
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warszawa, Poland
... ments production. Location of the potential plant promoter was computed by
the TSSP program [http://www. softberry.com]. Phylo- genies ...
Nucleic Acids Research
2005, Vol. 33, No. 3 1069–1076
Plant promoter prediction with confidence estimation
I. A. Shahmuradov(1), V. V. Solovyev(1,2,*) and A. J. Gammerman(1)
(1)Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK and (2)Softberry Inc., 116 Radio Circle,
Suite 400, Mount Kisco, NY 10549, USA
Accurate prediction of promoters is fundamental to
understanding gene expression patterns, where confidence
estimation is one of the main requirements.
Using recently developed transductive confidence
machine (TCM) techniques, we developed a new program
TSSP-TCM for the prediction of plant promoters
that also provides confidence of the prediction.
The Plant Journal
(2004) 37 (4), 517-527
Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein
X Sun et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China
.... Promoter regions of the Xa26 family members were analyzed with the promoter prediction
programs tssp (http://www.softberry.com/berry.phtml), nnpp (http://www ...
Plant Physiology
136:3023-3033 (2004)
Utility of Different Gene Enrichment Approaches Toward Identifying and Sequencing the Maize Gene Space
Nathan Michael Springer, Xiequn Xu and W. Brad Barbazuk
Center for Plant and Microbial Genomics, Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108 (N.M.S.); and Donald Danforth Plant Sciences Center, St. Louis, Missouri 63132 (X.X., W.B.B.)
...upstream sequence, 10 of the 33 genes had at least 1 kb
of upstream sequence, and the longest extension was
2.2 kb. This sequence is likely to contain 5# UTRs and
promoters. We attempted to determine how often
a putative PolII promoter recognition sequences could
be found using the Softberry TSSP package (Mount
Kisco, NY; http://www.softberry.com; Shahmuradov
et al., 2003), which uses characteristics of known factor
binding sites to predict potential transcription start
sites in plant DNA sequence. Putative promoters were
predicted in 13 of the 26 upstream sequences assayed,
and putative TATA boxes were identified in 9 (70%) of...
Nucleic Acids Research
2003, Vol. 31, No. 1 114-117
PlantProm: a database of plant promoter sequences
Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA
... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based
on discriminant analysis has been created by Softberry Inc. ...
Molecular Neurobiology
2016, pp.1-15. doi:10.1007/s12035-016-0156-0
Epigenetic Regulation of SNAP25 Prevents Progressive Glutamate Excitotoxicty in Hypoxic CA3 Neurons
Biswal, S. et al.,
1.Experimental Biology DivisionDefence Institute of High Altitude Research, Defence Research and Development OrganisationLeh-LadakhIndia
2.Department of PhysiologyAll India Institute of Medical SciencesBhubaneswarIndia
... sequences. TSSG (linux1.softberry. com ... condition. I SNAP25 promoter sequence
of rat genome, prediction of transcription factor AP1 and CREB binding site by
Softberry software (?300 to +100 from transcription start site). II ...
Journal of Biochemical Technology,
Vol 4, No 1 (2012)
Analysis of diabetic retinopathy biomarker VEGF gene by computational approaches
Jayashree Sadasivam, N Ramesh, K Vijayalakshmi, Vinni Viridi, Shiva prasad
... Gene promoters TSSG www.softberry.com/berry.tssp& group=programs&subgroup=pro moter
Proteins Data PDB www.rcsb.org Tandem repeats TRF finder http://tandem.bu.edu/trf/trf.sub
mit.options.html Docking Clusproprotei n-protein dock. Cluspro.bu.edu Page 3. ...
Nature Communications
4, Article number: 2739 doi:10.1038/ncomms3739
Genome-wide association study implicates NDST3 in schizophrenia and bipolar disorder
Lencz et al.,
Division of Research, Department of Psychiatry, The Zucker Hillside Hospital Division of the North Shore—Long Island Jewish Health System, Glen Oaks, New York 11004, USA
Center for Psychiatric Neuroscience, The Feinstein Institute for Medical Research, Manhasset, New York 11030, USA
... TATA boxes were predicted by TSSG (Softberry Inc) and the predicted TATA box locations were
depicted with vertical arrows (red on plus strand and blue on minus strand of chromosome 4).
In cross-species genomic sequence alignment, high sequence similarity was depicted ...
Gene
Volume 527, Issue 2, 25 September 2013, Pages 606–615 DOI:10.1016/j.gene.2013.05.078
Novel polymorphisms in UTR and coding region of inducible heat shock protein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus) and riverine buffalo (Bubalus bubalis)
M. Sodhi, M. Mukesh, A. Kishore, B.P. Mishra 1, R.S. Kataria, B.K. Joshi
National Bureau of Animal Genetic resources, Karnal 132001, India
... Microsatellite repeats were identified using Gramene software (http://www.gramene.org/db/markers/
ssrtool).The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.
gov/molbio/proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ...
J Biol Chem.
2012 Dec 19. [Epub ahead of print] DOI: 10.1074/jbc.M112.419168
MiR-125b Functions as a Key Mediator for Snail-Induced Stem Cell Propagation and Chemoresistance
Zixing Liu et al.,
1 University of South Alabama, United States;
2 Central South University, China;
... Western blotting. Luciferase Reporter Assay — The miR-125b promoter pGL3 basic
luciferase vector was constructed according to the literature and TSSG prediction
(http://linux1.softberry.com/berry.phtml? topic=products). pGL3 ...
Plant Biology,
14: 714–724. doi: 10.1111/j.1438-8677.2011.00556.x
Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula
Bucsenez, M., Ruping, B., Behrens, S., Twyman, R. M., Noll, G. A. and Prufer, D.
1
Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Aachen, Germany
2
Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat Munster, Munster, Germany
... MATERIAL AND METHODS In silico identification of the transcriptional start site and TATA box
The putative transcriptional start site and TATA box of the MtSEO-F1 promoter were predicted
using the Transcriptional Start Site Prediction (TSSP) tool from Softberry (http:// www ...
Mol Biol Rep.
2011 Aug;38(6):4153-7. doi: 10.1007/s11033-010-0535-y. Epub 2010 Nov 24.
Identification of the transcriptional promoters in the proximal regions of human microRNA genes
Long et al.,
Key Laboratory of Neurogenetics and Channelopathies of Guangdong Province and the Ministry of Education of China, Institute of Neuroscience and the Second Affiliated Hospital of Guangzhou Medical University, 250 Chang-gang-dong Road, Guangzhou, 510260, China
... It is shown that TSSG (http://www.softberry.ru/berry.phtml, Softberry) is a good promoter prediction
program with few false positive pre- dictions comparing to other promoter finding programs [17,
20]. Therefore, we used this program to predict the promoter regions and TSSs. ...
Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015
Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes
Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/
proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...
BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51
Identification of a novel temperature sensitive promoter in cho cells
Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria
2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria
... Computational analysis of this region was performed using several freely available online
prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/
berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...
Hum Genet.
2010 Jan 12. [Epub ahead of print]
PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis
Ishizaki et al.,
Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, 812-8582, Japan
... 2004). The values from three separate assays were compared between constructs. The
putative promoter region of PD1 gene was predi- cated using the TSSG (http://www.softberry.
com/berry. phtml?topic=tssg&group=programs&subgroup=promoter). ...
Glycobiology
Advance Access published November 22, 2010
Conservation of the ST6Gal I gene and its expression in the mammary gland
Jovana Maksimovic, Julie A. Sharp, Kevin R. Nicholas, Benjamin G. Cocks, Keith Savin
Centre for Reproduction and Development, Monash Institute of Medical Research, Clayton 3168 Australia
Biosciences Research Division, Department of Primary Industries, Bundoora 3083 Australia
Institute for Technology Research and Innovation, Deakin University, Geelong 3214 Australia
... TRANSCOMPEL (Kel-Margoulis, OV, Kel, AE, et al. 2002) database, as well as mononucleotide
position weight matrices for individual TFBS collected in TRANSFAC. Transcription start sites
were predicted using TSSG (Softberry). Page 24. 24 Acknowledgments ...
Acta Biochim Biophys Sin (Shanghai).
2009 Apr;41(4):309-15.
Identification and characterization of the minimal promoter of Mipu1: the role of GC boxes in the regulation of basal transcription
Lv B et al.,
Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha 410078, China.
... rat/). The Mipu1 gene transcription start site was predicted using Dragon GC + Promoter
Finder (http://sdmc.lit.org.sg/promoter/CGrich1_0/CGRICH.htm) and TSSG
(http://www.softberry.com/berry.phtml?topic=promoter). Promoterscan ...
European Journal of Cell Biology
Volume 88, Issue 12, December 2009, Pages 731-742
Molecular mechanisms underlying the pro-inflammatory synergistic effect of tumor necrosis factor ? and interferon ? in human microvascular endothelium
Lombardi et al.,
aDepartment of Clinical Physiopathology, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, Viale Pieraccini 6, I-50139 Florence, Italy
bDepartment of Internal Medicine, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, I-50139 Florence, Italy
... A 5-kb region upstream from the TNFa-RII and the IFNg-R open reading frames was analyzed
using the promoter identification programs promoter predictions (http://www.fruitfly.org/seq_tools/
promoter) and TSSG (http://softberry.com/berry.phtml?topic=tssg&group ...
Endocrinology
2009 Vol. 150, No. 4 1870-1878
Hypothalamic Expression of Eap1 Is Not Directly Controlled by Ovarian Steroids
Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa and Sergio R. Ojeda
Division of Neuroscience (V.M., S.R.O.), Oregon National Primate Research Center, Beaverton, Oregon 97006; and Department of Physiology and Pharmacology (C.M., R.A.S., D.M.D.), Oregon Health and Science University, Portland, Oregon 97239
... The position of a TSS was predicted using several search tools including Promoter 2.0 Prediction
server (http://www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder version 1.5
(http://research.i2r.a-star.edu.sg/promoter/promoter1_5/DPF.htm), and Softberry TSSG (http ...
Endocrinology
2008, doi:10.1210/en.2008-0779
Hypothalamic expression of Eap1 is not directly controlled by ovarian steroids
Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa, and Sergio R. Ojeda
Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon, USA; and Department of Physiology & Pharmacology, Oregon Health & Science University, Portland, Oregon, USA
... www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder v1.5 (http://research.
i2r.a- star.edu.sg/promoter/promoter1_5/DPF.htm) and Softberry TSSG (http://www ...
Endocrinology
2008, Vol. 149, No. 9 4256-4266
Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures
Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy
... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic
promoter identification programs (http://www.softberry.com/berry.phtml?topic=tssg&group=programs&subgroup=promoter ...
Animal Genetics
39(5):531-543, October 2008.
Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST
Meyers, S. N.; Beever, J. E.
... Putative promoter sequences and transcriptional start sites (TSSs) were predicted
using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...
Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95
Cloning and functional analysis of the promoter region of the human Disc large gene
Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy
bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina
... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research
Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...
Cancer Research
68, 8976-8985, November 1, 2008. doi: 10.1158/0008-5472.CAN-08-0769
Roles for MicroRNAs, miR-93 and miR-130b, and Tumor Protein 53–Induced Nuclear Protein 1 Tumor Suppressor in Cell Growth Dysregulation by Human T-Cell Lymphotrophic Virus 1
Yeung et al.,
Molecular Virology Section, Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland; 2 Laboratory of Virus Immunology, Institute for Virus Research, Kyoto University, Shogoin Kawahara-cho, Sakyo-ku, Kyoto, Japan;
... luciferase (f-luc) reporter gene. The putative promoter of miR-130b was predicted
by TSSG promoter prediction program. 6 PCR primers (sense ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...
BMC Genomics
2007, 8:203 doi:10.1186/1471-2164-8-203
In silico comparative genomic analysis of GABAA receptor transcriptional
regulation
Christopher J Joyce1§
1Faculty of Biological Sciences, The University of Leeds, Leeds, UK
Table 1 - Gene Regulation Prediction Software utilised
...TSSG TSS Prediction www.softberry.com ...
Nature and Science,
4(3), 2006
An In Silico Investigation into the Discovery of
Novel Cis-acting Elements within the Intronic Regions of Human PAX7
Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan
University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center),
New York City, New York 10021, USA
The names and functions of the programs used are:
...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) -
This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) -
TSSG is the most accurate mammalian cis element prediction program.
DNA and Cell Biology
Jun 2006, Vol. 25, No. 6 : 346 -358
Cloning and Characterization of the BRD7 Gene Promoter
Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Hunan, People's Republic of China
... The transcriptional initiation site was identified using the TSSG program
(http://www.softberry.com/berry.phtml?topic promoter) and Dragon GC Promoter Finder ...
Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223
GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis
ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.
... Consistent with this result, sequence analysis using TSSG and TSSW softwares (
http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...
International Journal of Fisheries and Aquatic Studies
2016; 4(3): 378-383
Isolation, characterization and activity analysis of selected promoters of mud crab, Scylla serrata
Mani, M. K., Neeli-Venkata, R., Kondadhasula, R., & Majumdar, K. C.
Post-Harvest Technology, Central Institute of Fisheries Education, Mumbai, India; Department Of Signal Processing, Tampere University Of Technology, Finland
.. Histone3 -R GGCGCTAGCTAGCTTCCTTCTT 2.3 Promoter nucleotide sequences analysis The
sequences thus obtained were analysed for potential transcription factor binding sites specific
for promoters using TSSW (http://linux1.softberry.com/berry.phtml) and ...
International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573
The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53
Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China
... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools:
NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp.
duke.edu/generegulation/McPromoterMMII/), and Softberry programs
FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...
J. Virol. June
2012 vol. 86 no. 12 6688-6700 DOI: 10.1128/JVI.07037-11
Feline Tetherin Is Characterized by a Short N-Terminal Region and Is Counteracted by the Feline Immunodeficiency Virus Envelope Glycoprotein
Celestino et al.,
aDepartment of Molecular Medicine, University of Padua, Padua, Italy
bRetrovirus Center and Virology Section, Department of Experimental Pathology, University of Pisa, Pisa, Italy
... The transcription initiation start site and the different cis-acting elements present in the putative
cBST2 promoter region were predicted by using the following programs: the TSSW prediction
program (Softberry), TFsitescan (MIRAGE [Molecular Informatics Resource for the ...
PLoS ONE
(2011), 6(10): e26944. doi:10.1371/journal.pone.0026944
A Common Genetic Variant (97906C>A) of DAB2IP/AIP1 Is Associated with an Increased Risk and Early Onset of Lung Cancer in Chinese Males.
Yang et al.,
The Institute for Chemical Carcinogenesis, The State Key Lab of Respiratory Disease, Guangzhou Medical University, Guangzhou, People's Republic of China
Department of Pathology, Yale University School of Medicine, New Haven, Connecticut, United States of America
...We used the TSSW program (http://www.softberry.ru/berry.phtml) to predict promoter region and found that the 4000 bp 5?-upstream region of DAB2IP gene are potential promoter region. ...
Molecular and Cellular Biology
January 2009, p. 570-581, Vol. 29, No. 2 doi:10.1128/MCB.01275-08
CUX1 and E2F1 Regulate Coordinated Expression of the Mitotic Complex Genes Ect2, MgcRacGAP, and MKLP1 in S Phase
Seguin et al.,
... sequences immediately upstream of the transcription start sites were analyzed with
the Genomatix suite (www.genomatix.de) and TSSW software (www.softberry.com ...
Animal Genetics
39(5):531-543, October 2008.
Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST
Meyers, S. N.; Beever, J. E.
... Putative promoter sequences and transcriptional start sites (TSSs) were predicted
using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...
Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95
Cloning and functional analysis of the promoter region of the human Disc large gene
Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy
bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina
... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research
Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...
BMC Bioinformatics.
2008; 9: 113.
Human Pol II promoter recognition based on primary sequences and free energy of dinucleotides
Jian-Yi Yang, Yu Zhou, Zu-Guo Yu, Vo Anh, and Li-Qian Zhou
1School of Mathematics and Computational Science, Xiangtan University, Hunan 411105, China
2School of Mathematical Sciences, Queensland University of Technology, GPO Box 2434, Brisbane, Q 4001, Australia
... of promoter prediction tools, which are available on-line, namely Neural Network
Promoter Prediction (NNPP version 2.2) [27], Soft Berry (TSSW) [28], Dragon ...
Mol. Cell. Biol.
doi:10.1128/MCB.01275-08
CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP and MKLP1 in S-phase
Seguin et al.,
INSERM U749, Faculte' de Pharmacie Paris XI, 92296 Cha^tenay-Malabry, France; and Molecular Oncology Group, McGill University, Montreal, Quebec, H3A 1A1, Canada
... with the genomatix suite (www.genomatix.de) and TSSW softwares (www.softberry.com).
These analyses did not identify consensus TATA boxes in these 3 promoters. ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...
Lung Cancer
2007 Volume 57, Issue 2, Pages 143-151
Polymorphisms of cytosolic serine hydroxymethyltransferase and risk of lung cancer: A case–control analysis
L. Wang, J. Lu, J. An, Q. Shi, M. Spitz, Q. Wei
Department of Epidemiology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77230-1439, United States.
.. fcgi%3Fdb=Snp), of which two SNPs were found to be located in the SHMT1 promoter
region as predicted by the online software TSSW (http://www.softberry.com/berry ...
Human Molecular Gene
2005 14(11):1465-1474; doi:10.1093/hmg/ddi156
Identification and characterization of a novel gene Saf transcribed from the opposite strand of Fas
Ming-De Yan et al.,
1Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC
... 1). After analysis with program TSSW (http://www.softberry.com), one promoter
was predicted upstream of the transcription start site. ...
Genomics
Volume 86, Issue 4, October 2005, Pages 489-494
L3mbtl, the mouse orthologue of the imprinted L3MBTL, displays a complex pattern of alternative splicing and escapes genomic imprintingstar, open
Li et al.,
aDepartment of Haematology, Cambridge Institute for Medical Research, University of Cambridge, Hills Road, Cambridge CB2 2XY, UK
bDepartment of Anatomy, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK
... which were predicted by promoter prediction programs including PROSCAN 1.7
(http://bimas.cit.nih.gov/molbio/proscan/) and TSSW (http://www.softberry.com/berry ...
J. Biol. Chem
Vol. 279, Issue 34, 35183-35192, August 20, 2004
STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes
Julia Travagli, Martine Letourneur, Jacques Bertoglio, and Josiane Pierre
From the INSERM U461, Faculte de pharmacie, 5 Rue J. B. Clement, 92296-Chatenay-Malabry, France
... The transcriptional start site was determined by computational analysis (TSSW using
Softberry Software) and predicted to be located at nucleotide -16 from ...
Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223
GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis
ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.
... Consistent with this result, sequence analysis using TSSG and TSSW softwares (
http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...
Genomics
2004 Sep;84(3):577-86.
Cloning, genomic structure, and expression profiles of TULIP1 (GARNL1), a brain-expressed candidate gene for 14q13-linked neurological phenotypes, and its murine homologue
Schwarzbraun T et al.,
Institute of Medical Biology and Human Genetics, Medical University of Graz, Harrachgasse 21/8, A-8010 Graz, Austria.
... Putative promoter regions were detected from human and murine genomic sequences
using the eukaryotic promoter prediction program TSSW from Softberry, Inc., http ...
Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297
Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene
Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA
... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms
(http://www.softberry.com/berry.phtml) were initially employed. ...