Recognition of exon-exon junctions in cDNA may be very useful for gene sequencing when starting with a sequence of cDNA clone. In a given cDNA sequence we need to select sites for PCR primers that (hopefully) lie in adjacent exons. Prediction is performed by linear discriminant function combining characteristics describing tipical sequences around exon-exon junctions.
We can not predict exon-exon junction position with very high accuracy, because some important information is being lost during splicing. We predict positions marked by '*', where 75% of potential exon-exon junctions are localized. Additionally, we mark '-' positions where exon-exon junctions atr absent with probability about 90%. We recommend to select primer sequences in continuous '-' regions that do not cross '*' or ' ' positions.
Solovyev V.V.,Salamov A.A., Lawrence C.B.
Predicting internal exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames.
(Nucl.Acids Res.,1994,22,24,5156-5163).
RNASPL output: First line - name of your sequence Second line - your sequence 3d line - '*' shows potential exon-exon junction position (Pr > 0.75)
'-' shows position where exon-exon junction absent (Pr > 0.90)
'n' is nonanalyzed flanking position For example: HSACHG7 690 bp DNA PRI 18-DEC-1990
10 20 30 40 50 60 ATGGCGGCGACGGCGAGTGCCGGGGCCGGCGGGATGGACGGGAAGCCCCGTACCTCCCCT nnnnnnnnnnnnnnnnnnnn-------- ---------*---- ----*---------- 70 80 90 100 110 120 AAGTCCGTCAAGTTCCTGTTTGGGGGCCTGGCCGGGATGGGAGCTACAGTTTTTGTCCAG ----- *----*--------- -- --------*------- --------------- - 130 140 150 160 170 180 CCCCTGGACCTGGTGAAGAACCGGATGCAGTTGAGCGGGGAAGGGGCCAAGACTCGAGAG -----------*-*--- ---- ------ --*----- -----------*------ -- 190 200 210 220 230 240 TACAAAACCAGCTTCCATGCCCTCACCAGTATCCTGAAGGCAGAAGGCCTGAGGGGCATT ------ ---------- ---------------- ------------------------ 250 260 270 280 290 300 TACACTGGGCTGTCGGCTGGCCTGCTGCGTCAGGCCACCTACACCACTACCCGCCTTGGC ----- -- ------------------------------------------------ --